Skip to contents Skip to Global Navigation Menu
  • KDCA
  • Contact us
  • E-Submission

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS. pISSN: 2210-9099. eISSN: 2233-6052
Original Article

Molecular and genetic characterization of Kudoa septempunctata from foodborne outbreaks in the Republic of Korea, 2016–2024: a retrospective public-health surveillance investigation


Published online: May 14, 2026

1Division of Vectors and Parasitic Diseases, Korea Disease Control and Prevention Agency, Cheongju, Republic of Korea

2Division of Antimicrobial Resistance Control, Korea Disease Control and Prevention Agency, Cheongju, Republic of Korea

3Division of Disease Control Research Planning, Korea Disease Control and Prevention Agency, Cheongju, Republic of Korea

Corresponding author: Hee-Il Lee Division of Vectors and Parasitic Diseases, Korea Disease Control and Prevention Agency, 187 Osongsaenmyeong 2-ro, Osong-eup, Heungdeok-gu, Cheongju 28159, Republic of Korea E-mail: isak@korea.kr
• Received: October 2, 2025   • Revised: February 12, 2026   • Accepted: March 29, 2026

© 2026 Korea Disease Control and Prevention Agency.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  • 240 Views
  • 11 Download
  • Objectives
    Kudoa septempunctata is a marine myxosporean parasite implicated in seafood-borne acute gastroenteritis, predominantly associated with the consumption of raw olive flounder. This study aimed to characterize the molecular and genetic features of K. septempunctata-associated with foodborne outbreaks in the Republic of Korea from 2016 to 2024.
  • Methods
    We reviewed 415 suspected foodborne outbreaks reported through national surveillance between 2016 and 2024. Among these, 37 outbreaks with complete clinical, epidemiological, and laboratory data from 2020 to 2024—including K. septempunctata testing and genotyping—were analyzed in detail.
  • Results
    Diarrhea (88.8%) and vomiting (61.2%) were the most common symptoms. The detection rate of K. septempunctata was significantly higher in specimens collected ≤24 hours after raw fish consumption (69.8%) than in those collected >24 hours after consumption (35.9%). Outbreak occurrence was higher during warmer months (May–October) than during other periods, although this difference was not statistically significant. All sequences obtained from patient specimens belonged to sequence type 3 (ST3) of K. septempunctata.
  • Conclusion
    Since 2020, the proportion of reported outbreaks associated with Kudoa has increased, indicating its continued public health relevance. The timing of specimen collection is a key determinant of K. septempunctata detection, as diagnostic yield declines significantly when specimens are collected more than 24 hours after exposure. These findings highlight the need for standardized rapid investigation protocols and an integrated surveillance system linking clinical data with seafood supply-chain information.
Kudoa septempunctata, a myxosporean parasite originally identified in olive flounder (Paralichthys olivaceus), has been implicated in foodborne gastroenteritis associated with the consumption of raw olive flounder. In 2012, the Ministry of Health, Labour and Welfare of Japan designated K. septempunctata as a foodborne pathogen [13]. Previous epidemiological reports have described vomiting, diarrhea, and abdominal pain as the principal symptoms of foodborne illness caused by K. septempunctata, with most patients recovering within 24 hours [3]. Humans are considered accidental hosts and are exposed through the ingestion of infected fish tissue, particularly when fish is consumed raw or undercooked [4,5]. Although K. septempunctata demonstrates high host specificity for olive flounder, sporadic infections have been reported in other species, including wild grass puffer (Takifugu alboplumbeus), Japanese whiting (Sillago japonica), and black scraper (Thamnaconus modestus) [6,7]. Because the spore density of K. septempunctata in these incidental hosts is relatively low, their potential to cause human illness appears limited. Nevertheless, olive flounder remains the primary vector implicated in human foodborne outbreaks associated with K. septempunctata.
K. septempunctata belongs to the class Myxosporea and possesses 6 or 7 shell valves with polar capsules [8]. Its natural life cycle has not been fully elucidated. Although many myxosporeans use annelids as alternate hosts, no definitive intermediate host has been identified for K. septempunctata; therefore, general myxosporean life-cycle paradigms are referenced without proposing a specific annelid host [911]. Animal experiments involving K. septempunctata have demonstrated transient gastrointestinal symptoms in some models, whereas others have shown little or no histological evidence of tissue injury [3,1214]. Therefore, polymerase chain reaction (PCR) positivity for K. septempunctata in stool or vomit indicates recent exposure but does not, by itself, establish that the parasite caused the illness [4].
Mitochondrial sequence types of K. septempunctata, defined by cox1/rnl haplotypes, are classified as sequence type 1 (ST1; cox1-1/rnl-1), sequence type 2 (ST2; cox1-2/rnl-2), and sequence type 3 (ST3; cox1-3/rnl-2), with ST3 predominating in the Republic of Korea (ROK) [15,16]. Although genotype-phenotype relationships are well established for other enteric pathogens, such as Cryptosporidium and norovirus [17,18], the clinical relevance of K. septempunctata sequence types, particularly ST3, remains unclear. This uncertainty underscores the need for integrated epidemiological and molecular analyses.
In the ROK, K. septempunctata has been monitored as a foodborne pathogen since 2015 and was incorporated into the National Water and Foodborne Disease Guidelines in 2017 [19,20]. From 2016 to 2019, surveillance focused on laboratory detection (presence or absence of Kudoa) and lacked standardized clinical and epidemiological data. To address this gap, standardized investigation workflows for foodborne illness caused by K. septempunctata were implemented in 2020.
Accordingly, this study aimed to elucidate the molecular and genetic characteristics of K. septempunctata outbreaks and to provide a scientific basis for effective public health interventions in the ROK. By analyzing nationwide surveillance data from 2016 to 2024, focusing on and conducting in-depth analyses of specific outbreaks from 2020 to 2024, we sought to determine the predominant K. septempunctata sequence types, evaluate seasonal outbreak trends, and assess the effect of the interval between consumption and specimen collection on pathogen detection rates.
Outbreak Criteria
We defined a Kudoa-associated outbreak as the occurrence of 2 or more epidemiologically linked cases with compatible gastrointestinal symptoms after the consumption of raw fish, typically raw olive flounder. Confirmed outbreaks required at least 1 case to be PCR-positive for K. septempunctata rRNA, with alternative enteric pathogens excluded through laboratory testing or deemed unlikely on the basis of incompatible incubation periods. Events that did not satisfy all of these criteria were classified as possible Kudoa-associated outbreaks. Among the total reported cases, we analyzed 37 outbreaks occurring between 2020–2024 and evaluated standardized variables, including outbreak date, number of patients, and symptom types [20]. Outbreaks were categorized geographically according to the location where cases were identified and field investigations were conducted, as determined by the investigating public health centers (PHCs) or health and environment research institutes (HERIs), rather than by the production origin of the implicated seafood.
Specimen Collection and Ethical Statement
A total of 1,200 clinical specimens (stool and/or vomitus) were tested to identify pathogens in patients presenting with diarrhea or vomiting after suspected seafood-borne illness outbreaks during 2016–2024. This study focused exclusively on the molecular detection and genetic typing of K. septempunctata in clinical specimens because food samples, including leftover raw fish, were not included in the analysis. This study was conducted as a retrospective public-health surveillance investigation using specimens collected after symptom onset, and leftover fish from the exposure meal was not available for collection or testing. Clinical specimens were collected primarily at PHCs from suspected cases and were then referred to provincial HERIs under cold-chain conditions for testing [21].
In this study, a retrospective analysis was performed using data collected during routine public health investigations for outbreak diagnosis. Institutional review board approval was waived because the data had been collected for diagnostic purposes during public health practice rather than for human participant research.
DNA Extraction and PCR Assays
Total DNA was extracted from approximately 250 mg of each clinical specimen (stool and/or vomitus) using the FastDNA SPIN Kit for Soil (MP Biomedicals) after mechanical disruption with a FastPrep-24 instrument (MP Biomedicals) at 6.0 m/s for 40 seconds. To detect K. septempunctata, nested PCR targeting the 18S and 28S rRNA genes was performed using a thermal cycler (C1000 Touch Thermal Cycler; Bio-Rad Laboratories) (Table 1) [22]. The cycling conditions for the primary PCR were 95 °C for 5 minutes; 35 cycles of 95 °C for 30 seconds, 60 °C for 45 seconds, and 72 °C for 30 seconds; followed by 72 °C for 5 minutes. The cycling conditions for the secondary PCR were 95 °C for 5 minutes; 35 cycles of 95 °C for 30 seconds, 58 °C for 45 seconds, and 72 °C for 30 seconds; followed by 72 °C for 5 minutes. From 2021 onward, a multiplex real-time PCR assay (PowerChek K. septempunctata 18S/28S rRNA Real-time PCR Kit II; Kogene Biotech) was used for screening.
Determination of Sequence Type
For mitochondrial typing of K. septempunctata, the cytochrome c oxidase subunit I (cox1) and large-subunit rRNA (rnl) genes were amplified by nested PCR [16]. The amplified DNA fragments were sequenced, and phylogenetic trees were constructed using the maximum-likelihood method with the Kimura 2-parameter model in MEGA 11 and 1,000 bootstrap replicates to determine the sequence type (ST1, ST2, or ST3).
Statistical Analysis
Statistical analyses were performed using IBM SPSS Statistics ver. 25.0 (IBM Corp.), with statistical significance set at α=0.05. Seasonality was assessed by comparing the proportion of Kudoa-positive outbreaks between May–October and November–April using Pearson’s χ² test. The effect of specimen collection timing on K. septempunctata detection was analyzed using Fisher’s exact test by comparing specimens collected ≤24 hours with those collected >24 hours after contaminated food consumption. Relative risk (RR) with 95% confidence intervals (CIs) was calculated for both analyses.
Detection of K. septempunctata in Clinical Specimens
Of the 415 outbreaks linked to olive flounder sashimi, 237 events (57.1%) met the prespecified definition of Kudoa-associated outbreaks. The proportion of outbreaks confirmed as Kudoa-associated increased from 2016 and peaked at 77.8% in 2020. During 2021–2024, although the number of reported outbreaks decreased, K. septempunctata was consistently identified in nearly all tested outbreaks (e.g., 5/7 in 2023 and 10/12 in 2024; Figure 1A). By region, the number of outbreaks was highest in Gyeonggi-do, followed by Gyeongsangbuk-do and Seoul (Table 2). Overall, 431 of 1,200 clinical specimens (35.9%) tested positive for K. septempunctata. Except for 2 outbreaks in which enteropathogenic Escherichia coli (EPEC) was identified and 1 outbreak in which norovirus was detected in 2020, no other pathogens were identified in specimens during the study period.
Epidemiological Analysis of Outbreaks
An epidemiological analysis was performed for 37 Kudoa-associated foodborne outbreaks identified between 2020 and 2024 (Table 3). All outbreaks involved the consumption of raw fish, primarily olive flounder. The mean attack rate across outbreaks was 87.5% (range, 25%–100%). The mean symptom onset time was 5 hours (range, 1.2–11 hours) after consumption of the contaminated food. The most common symptom was diarrhea, reported in 88.8% of patients, followed by vomiting (61.2%) and abdominal pain (32.7%). Outbreaks tended to occur more frequently during warmer months (May–October; Figure 2) than during colder months, with a notable peak in August (14.8%). However, this seasonal difference was not statistically significant (RR, 1.14; 95% CI, 0.93–1.39; p=0.115). The clinical-specimen detection rate of K. septempunctata averaged 53.6%, ranging from 16.7% to 100.0% across outbreaks.
Correlation Between Specimen Collection Interval and Pathogen Positivity
To assess the effect of the interval between contaminated food consumption and specimen collection on diagnostic yield, we analyzed 112 specimens for which complete timing data were available in the epidemiological investigation forms. Among specimens collected ≤24 hours after consumption, 69.8% (44/63) tested positive. In contrast, only 35.9% (14/39) of specimens collected >24 hours after consumption were positive. This difference was statistically significant (RR, 1.95; 95% CI, 1.24–3.05; Fisher’s exact test, p=0.0010), indicating that prompt sampling nearly doubled the diagnostic yield. Specimens with unknown intervals (n=10; 4 positive) were excluded from this comparison.
National surveillance data indicate an increase in reported Kudoa-associated outbreaks since 2020. Although previous investigations emphasized laboratory detection and suggested possible dose-response relationships [23], PCR positivity alone indicates only the presence of K. septempunctata DNA and cannot establish causation without clinical correlation [1,4,12]. A recent prospective cohort study in the ROK reported a statistically significant association between consumption of K. septempunctata-infected farmed olive flounder and the occurrence of acute gastrointestinal symptoms [24]. In that cohort, symptoms occurred more frequently and were more severe among participants who consumed larger amounts of K. septempunctata-positive olive flounder, particularly at higher infection intensities [24]. Clinically, acute diarrhea and vomiting predominated among cases of foodborne illness associated with K. septempunctata in the ROK [19], consistent with reports from Japan [2,25].
Prompt specimen collection after contaminated food consumption is essential. Our results demonstrated a significant decline in K. septempunctata detection rates after more than 24 hours had elapsed since contaminated food consumption. This time-dependent decline is consistent with previous outbreak investigations in Japan, in which the detection rate of K. septempunctata in stool decreased significantly when specimens were collected more than 2.5 days after contaminated food consumption [1]. In addition, experimental studies have shown that myxospores can be detected in feces within hours of exposure, supporting the narrow diagnostic window observed in our surveillance data [13]. This short detection window is consistent with observations that spores are rapidly excreted and lack the capacity to colonize or proliferate in the mammalian gastrointestinal tract [12]. In epidemiological investigations, specimen collection times are typically recorded in days (e.g., 0.5, 1, or 2 days); accordingly, we used 24 hours as the reference cutoff.
Regarding seasonality, our data showed a visual trend toward an increased number of Kudoa-positive outbreaks from May to October, with a notable peak in August. However, this apparent increase was not statistically significant (p=0.115). This seasonal pattern appears broader than that reported in Japan, where foodborne illness caused by K. septempunctata occurs predominantly between August and November [3]. The tendency toward more gastroenteritis cases caused by K. septempunctata during warmer months in the ROK may be partly explained by seasonal variation in raw olive flounder consumption [26]. Therefore, integrating seafood consumption data with epidemiological surveillance is essential for understanding the transmission dynamics of K. septempunctata.
During the study period, the number of reported patients with K. septempunctata infection decreased between 2020 and 2021, coinciding with the coronavirus disease 2019 pandemic. This decrease may have been attributable to social distancing measures, which likely reduced dining out and the consumption of raw fish, rather than to a biological decline in parasite prevalence. Although social distancing measures were relaxed between 2022 and 2024, patient numbers did not fully return to prepandemic levels, and the reasons for this pattern remain unclear. In addition, higher seawater temperatures have been associated with an increased prevalence of other Kudoa spp. [2729], raising the possibility that environmental factors influence the epidemiology of K. septempunctata infections. This hypothesis warrants longitudinal monitoring.
All identified specimens belonged to the ST3 genotype (Figure 3), consistent with the known distribution in the ROK, whereas ST1 and ST2 predominate in Japan [15,16]. The clinical significance of each sequence type remains uncertain, and published data regarding differences in virulence are conflicting. Recently, Shamsi and Barton [30] reviewed the global potential of Kudoa spp. as emerging seafood-borne parasites and noted that, as the consumption of raw fish expands globally, these regional genotypes may have implications beyond East Asia. They also noted that Kudoa-associated gastroenteric symptoms can be easily confused with viral or bacterial gastroenteritis, which may contribute to misdiagnosis or underdiagnosis, and that new hosts and expanded distribution patterns are increasingly reported [30]. Comparative studies evaluating sequence type-specific pathogenicity are needed to refine risk assessments of gastroenteritis associated with K. septempunctata.
The biological plausibility that K. septempunctata exposure can cause transient gastrointestinal symptoms in humans is supported by animal-model studies. Some studies have shown that K. septempunctata spores induce transient gastrointestinal symptoms, including diarrhea and fluid accumulation, in suckling mice, with resolution within 24 hours [2]. Vomiting has also been observed in musk shrews [2]. In contrast, other studies have reported detection of parasite DNA in mice without overt symptoms [12,13]. Taken together, these findings indicate that stool PCR positivity is evidence of recent exposure rather than definitive proof of pathogenic causation in an individual case. Moreover, the parasite appears unable to colonize or proliferate within the mammalian gastrointestinal tract, resulting in rapid excretion of K. septempunctata and a short detection window that is much narrower than that of pathogens capable of replicating in the gut [3133]. More recent in vitro and in vivo studies have suggested that K. septempunctata may impair intestinal epithelial barrier integrity and stimulate serotonin release, providing a potential mechanistic basis for the acute gastrointestinal symptoms observed in affected individuals [34].
Foodborne outbreaks linked to raw olive flounder continue to occur nationwide. Regional counts were highest in Gyeonggi-do, a pattern similar to the clustering of norovirus cases reported in metropolitan areas with high population density [21,23]. Because fish provenance has not been systematically recorded and seafood distribution networks move products from coastal production sites, such as Jeju-do, to inland markets, provincial counts likely reflect locations of consumption rather than production.
Despite the strengths of national surveillance, this study has several limitations. A major limitation is the absence of laboratory testing of food samples. Because of the retrospective nature of the surveillance data, matched leftover raw-fish specimens could not be obtained or analyzed. Consequently, although the epidemiological links were strong, we could not directly confirm the presence of the parasite in the implicated food items. This limitation complicates causal interpretation in mixed-infection scenarios. For example, in 3 outbreaks (outbreaks 1, 9, and 10) in which norovirus or EPEC was identified, alternative pathogens were carefully considered. Norovirus was considered less likely in outbreak 1 because symptom onset was short (<6 hours). Similarly, in outbreaks 9 and 10, symptoms appeared within 3–4 hours and resolved within 1 day, making EPEC an unlikely explanation. These findings are most consistent with Kudoa-associated illness, given the timing and test results.
More broadly, the absence of systematic dietary histories and the potential influence of unmeasured confounders, such as co-exposures and recall limitations, are important constraints. Future studies should incorporate standardized dietary surveys together with fish provenance and supply-chain information, including farmed versus wild origin, domestic versus imported source, and distribution pathways. These data should be integrated with experimental parasitology, such as host-parasite interaction assays and barrier-function models, to combine human, product, and environmental information.
In summary, this study confirms that K. septempunctata remains a significant cause of foodborne outbreaks in the ROK and is characterized predominantly by the ST3 genotype. A key finding for public health practice is the time-dependent nature of detection: prompt specimen collection, ideally within 24 hours of contaminated food consumption, is essential for maximizing diagnostic yield because of the rapid excretion of the parasite. Although K. septempunctata-associated outbreaks occur year-round, further investigation of environmental drivers and consumption patterns is warranted. To mitigate future risk, control strategies should evolve from reactive outbreak investigation to proactive monitoring of the olive flounder supply chain through an integrated system linked to standardized epidemiological surveillance.
Kudoa septempunctata is a causative agent of seafood-borne gastroenteritis.
• We analyzed 415 disease outbreaks reported in the Republic of Korea from 2016 to 2024.
• Outbreaks were most common in August, consistent with fish consumption data.
• All isolates belonged to the ST3 genotype of K. septempunctata.

Ethics Approval

Not applicable.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Funding

This research was funded by the Korea Disease Control and Prevention Agency (KDCA; 6331-311-210-13) of the Republic of Korea.

Availability of Data

All data generated or analyzed during this study are included in this published article. Other data are available from the corresponding author upon request.

Authors’ Contributions

Conceptualization: JHC, SHH, HIL; Data curation: JHC, CYK, JYK, JYS, SJJ; Formal analysis: JHC, SHH; Funding acquisition: JWJ, HIL; Investigation: JHC, CYK, JYK, JYS, SJJ; Methodology: JHC, SHH, JYK, JYS, TYK; Project administration: SHH, TYK, JWJ, HIL; Resources: all authors; Software: JHC; Supervision: SHH, TYK, JWJ, HIL; Validation: JHC, CYK, JYK, JYS, SJJ; Visualization: JHC, SHH; Writing–original draft: JHC, SHH; Writing–review & editing: JHC, SHH, TYK, HIL. All authors read and approved the final manuscript.

Figure 1.
Epidemiological trends in Kudoa septempunctata-associated foodborne outbreaks and clinical-specimen testing in the Republic of Korea, 2016–2024. (A) Annual trends in Kudoa-associated outbreaks. The bars represent the total number of suspected outbreaks (yellow) and confirmed Kudoa-associated outbreaks (orange), and the line indicates the outbreak positivity rate (green). (B) Annual trends in Kudoa detection in clinical specimens. The bars represent the total number of specimens tested (yellow) and Kudoa-positive specimens (orange), and the line indicates the specimen positivity rate (green).
Figure 1. Epidemiological trends in Kudoa septempunctata-associated foodborne outbreaks and clinical-specimen testing in the Republic of Korea, 2016–2024. (A) Annual trends in Kudoa-associated outbreaks. The bars represent the total number of suspected outbreaks (yellow) and confirmed Kudoa-associated outbreaks (orange), and the line indicates the outbreak positivity rate (green). (B) Annual trends in Kudoa detection in clinical specimens. The bars represent the total number of specimens tested (yellow) and Kudoa-positive specimens (orange), and the line indicates the specimen positivity rate (green).
	 
Figure 2.
Monthly distribution of Kudoa-positive foodborne outbreaks in the Republic of Korea from 2016 to 2024. The bars represent the number of Kudoa-positive outbreaks, and the line indicates the specimen positivity rate (green).
Figure 2. Monthly distribution of Kudoa-positive foodborne outbreaks in the Republic of Korea from 2016 to 2024. The bars represent the number of Kudoa-positive outbreaks, and the line indicates the specimen positivity rate (green).
	 
Figure 3.
Phylogenetic relationships based on the cox1 (A) and rnl (B) genes of Kudoa septempunctata isolated from foodborne disease cases in the Republic of Korea from 2016 to 2024. Phylogenetic trees were constructed from nucleotide-sequence alignments using the maximum-likelihood method with the Kimura 2-parameter model. Numbers in parentheses indicate the number of specimens sequenced in each year. Blue circles represent Kudoa-positive samples for the cox1 gene, and red circles represent those for the rnl gene in the present study. KDCA, Korea Disease Control and Prevention Agency.
Figure 3. Phylogenetic relationships based on the cox1 (A) and rnl (B) genes of Kudoa septempunctata isolated from foodborne disease cases in the Republic of Korea from 2016 to 2024. Phylogenetic trees were constructed from nucleotide-sequence alignments using the maximum-likelihood method with the Kimura 2-parameter model. Numbers in parentheses indicate the number of specimens sequenced in each year. Blue circles represent Kudoa-positive samples for the cox1 gene, and red circles represent those for the rnl gene in the present study. KDCA, Korea Disease Control and Prevention Agency.
	 
Table 1.
Polymerase chain reaction primers for the diagnosis of Kudoa septempunctata
Table 1.
Gene Primer Sequence (5′→3′) Size (bp) Reference
18S rRNA 1st K18-1st-F GGTGGGAGCATTTATTAGAGCT 648 [22]
K18-1st-R AATCGAGACCACTGTCAAC
2nd K18-2nd-F AGAAATACCGGAGTGGACCGTAAAATG 333
K18-2nd-R GTTCCATGCTATAACATTCAAGCGTTCG
28S rRNA 1st K28-1st-F TGCGAGTGAAGCGGGAAAA 717
K28-1st-R GTGTTTCAAGACGGGTCGG
2nd K28-2nd-F GTGTGTGATCAGACTTGATATG 356
K28-2nd-R AAGCCAAAACTGCTGGCCATTT
Table 2.
Regional summary of outbreaks and clinical specimens from investigations of Kudoa-associated gastroenteritis linked to raw olive flounder, 2016–2024
Table 2.
Region Total outbreaks (n) Kudoa-associated outbreaks (n, %)a) Specimens tested (n) Kudoa-positive specimens (n, %)b)
Gyeonggi-do 123 67 (54.5) 344 116 (33.7)
Gyeongsangbuk-do 65 33 (50.8) 223 59 (26.5)
Seoul 54 31 (57.4) 156 53 (34.2)
Gyeongsangnam-do 35 28 (80.0) 120 63 (52.5)
Daegu 25 19 (76.0) 53 31 (58.5)
Busan 25 12 (48.0) 64 19 (29.7)
Chungcheongnam-do 17 12 (70.6) 47 36 (76.6)
Jeju 16 10 (62.5) 32 14 (43.8)
Chungcheongbuk-do 24 6 (25.0) 76 11 (14.5)
Gangwon 5 5 (100.0) 14 8 (57.1)
Ulsan 5 4 (80.0) 11 8 (72.7)
Daejeon 9 3 (33.3) 15 3 (20.0)
Jeollabuk-do 3 3 (100.0) 5 3 (60.0)
Incheon 2 2 (100.0) 6 5 (83.3)
Jeollanam-do 6 2 (33.3) 32 2 (6.3)
Gwangju 1 0 (0) 2 0 (0)
Total 415 237 (57.1) 1,200 431 (35.9)

a)Kudoa-associated outbreak rate (%)=(no. of Kudoa-associated outbreaks/total no. of outbreaks)×100.

b)Kudoa-positive specimen rate (%)=(no. of Kudoa-positive specimens/no. of specimens tested)×100.

Table 3.
Summary of epidemiological investigation reports of Kudoa-associated foodborne outbreaks in the Republic of Korea, 2020–2024
Table 3.
Outbreak no.a) Symptom onset time (h)b) Time interval (h)c) Persons with symptoms (n) Persons who consumed contaminated food (n) Attack rate (%)d) Diarrhea (%) Vomiting (%) Abdominal pain (%) Persons who were Kudoa-positive (n/total n, %)e)
1 6 12 2 2 100 100 0 100 1 (50)
2 3 12 1 2 50 100 0 0 1 (50)
3 - 48 3 12 25 100 0 100 2 (16.7)
4 - 12 3 3 100 100 0 0 3 (100)
5 - 12 2 2 100 100 0 0 2 (100)
6 2 36 3 3 100 100 0 0 2 (66.7)
7 - - 3 3 100 100 100 0 2 (66.7)
8 2.5 48 1 2 50 100 100 0 1 (50)
9 3.5 72 3 3 100 100 100 100 1 (33.3)
10 3 24 5 5 100 60 100 0 3 (60)
11 11 48 7 7 100 100 0 0 1 (14.3)
12 8 48 4 4 100 50 50 0 1 (25)
13 - - 5 5 100 0 0 100 1 (20)
14 - - 2 2 100 0 0 100 1 (50)
15 8 72 1 2 50 100 100 0 1 (50)
16 4 12 1 2 50 100 100 0 1 (50)
17 8 12 2 2 100 100 100 0 2 (100)
18 8 29 5 5 100 100 100 0 5 (40)
19 4 12 2 2 100 100 100 100 2 (100)
20 4 24 2 2 100 100 0 100 2 (100)
21 4 48 2 2 100 100 100 100 2 (100)
22 4 12 1 2 50 100 100 0 1 (50)
23 4 24 2 2 100 100 100 0 2 (100)
24 4 12 2 2 100 100 100 100 2 (100)
25 3 72 2 2 100 100 100 0 2 (100)
26 10 24 6 6 100 100 100 0 4 (66.7)
27 8 48 2 2 100 100 100 0 2 (100)
28 2 24 4 4 100 100 100 0 2 (50)
29 5 48 2 2 100 100 100 0 2 (100)
30 3 24 3 3 100 100 100 0 2 (66.7)
31 11 24 2 2 100 100 0 100 2 (100)
32 4 24 2 2 100 100 100 0 2 (100)
33 1.2 24 2 2 100 100 100 0 2 (100)
34 4 24 2 2 100 100 100 0 2 (100)
35 6 24 3 3 100 100 100 100 2 (66.7)
36 3 12 2 2 100 100 0 100 2 (100)
37 5 24 2 2 100 100 0 100 2 (100)
Average 5.0 30.1 2.6 3.0 87.5 (98/112) 88.8 (87/98) 61.2 (60/98) 32.7 (32/98) 55.4 (62/112)

a)This result may differ from the number of outbreaks reported annually according to the waterborne and foodborne infectious disease management guidelines of the Korea Disease Control and Prevention Agency.

b)Symptom onset time: interval between consumption of raw olive flounder and the first gastrointestinal symptom; “-” indicates not recorded.

c)Time interval: time from consumption of raw olive flounder to collection of the first patient specimen.

d)Attack rate (%)=(no. of symptomatic persons/no. of persons who consumed the implicated food)×100.

e)Kudoa-positive persons (n/total n, %)=(no. of Kudoa-positive persons/no. of persons tested)×100; if a person submitted multiple specimens, positivity was counted once per person.

  • 1. Harada T, Kawai T, Jinnai M, et al. Detection of Kudoa septempunctata 18S ribosomal DNA in patient fecal samples from novel food-borne outbreaks caused by consumption of raw olive flounder (Paralichthys olivaceus). J Clin Microbiol 2012;50:2964−8.
  • 2. Kawai T, Sekizuka T, Yahata Y, et al. Identification of Kudoa septempunctata as the causative agent of novel food poisoning outbreaks in Japan by consumption of Paralichthys olivaceus in raw fish. Clin Infect Dis 2012;54:1046−52.
  • 3. Sugita-konishi Y, Sato H, Ohnishi T. Novel foodborne disease associated with consumption of raw fish, olive flounder (Paralichthys olivaceus). Saf 2014;2:141−50.
  • 4. Chung YB, Bae JM. Is there evidence that Kudoa septempunctata can cause an outbreak of acute food poisoning? Epidemiol Health 2017;39:e2017004.
  • 5. Reis LL, Jesus LC, Fernandes OC, et al. First report of Myxobolus (Cnidaria: Myxozoa) spores in human feces in Brazil. Acta Amaz 2019;49:162−5.
  • 6. Kasai A, Li YC, Mafie E, et al. New host records of monacanthid fish for three Kudoa spp. (K. septempunctata, K. thyrsites, and K. shiomitsui) prevalent in the olive flounder (Paralichthys olivaceus), with the description of K. parathyrsites n. sp. from a black scraper (Thamnaconus modestus). Parasitol Res 2016;115:2741−55.
  • 7. Shirakashi S, Shin SP, Mekata T, et al. Infections of Kudoa septempunctata (Myxozoa: Multivalvulida) in Wild Grass Puffer Takifugu alboplumbeus and Japanese Whiting Sillago japonica. Fish Pathol 2021;56:140−8.
  • 8. Matsukane Y, Sato H, Tanaka S, et al. Kudoa septempunctata n. sp. (Myxosporea: Multivalvulida) from an aquacultured olive flounder (Paralichthys olivaceus) imported from Korea. Parasitol Res 2010;107:865−72.
  • 9. Lom J, Dykova I. Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol 2006;53:1−36.
  • 10. Holzer AS, Bartosova-Sojkova P, Born-Torrijos A, et al. The joint evolution of the Myxozoa and their alternate hosts: a cnidarian recipe for success and vast biodiversity. Mol Ecol 2018;27:1651−66.
  • 11. Rocha S, Rangel LF, Casal G, et al. Involvement of sphaeractinomyxon in the life cycle of mugiliform-infecting Myxobolus (Cnidaria, Myxosporea) reveals high functionality of actinospore morphotype in promoting transmission. Parasitology 2020;147:1320−9.
  • 12. Ahn M, Woo H, Kang B, et al. Effect of oral administration of Kudoa septempunctata genotype ST3 in adult BALB/c mice. Parasite 2015;22:35.
  • 13. Jang Y, Ahn M, Bang H, et al. Effects of Kudoa septempunctata genotype ST3 isolate from Korea on ddY suckling mice. Parasite 2016;23:18.
  • 14. Ohnishi T, Kikuchi Y, Furusawa H, et al. Kudoa septempunctata invasion increases the permeability of human intestinal epithelial monolayer. Foodborne Pathog Dis 2013;10:137−42.
  • 15. Sung GH, Park IJ, Koo HS, et al. Molecular detection and genotype analysis of Kudoa septempunctata from food poisoning outbreaks in Korea. Parasites Hosts Dis 2023;61:15−23.
  • 16. Takeuchi F, Ogasawara Y, Kato K, et al. Genetic variants of Kudoa septempunctata (Myxozoa: Multivalvulida), a flounder parasite causing foodborne disease. J Fish Dis 2016;39:667−72.
  • 17. Audebert C, Bonardi F, Caboche S, et al. Genetic basis for virulence differences of various Cryptosporidium parvum carcinogenic isolates. Sci Rep 2020;10:7316.
  • 18. Hur E, Jeong I, Kwon S, et al. Trends in norovirus distribution among the children of childcare center. J Bacteriol Virol 2023;53:11−8.
  • 19. Korea Disease Control and Prevention Agency (KDCA) (KR). Epidemiologic investigation of infectious diseases in Korea annual report 2015. KDCA; 2016. Korean.
  • 20. Korea Disease Control and Prevention Agency (KDCA) (KR). Guideline for water & foodborne diseases prevention and control. KDCA; 2017. Korean.
  • 21. Korea Disease Control and Prevention Agency (KDCA) (KR). Epidemiologic investigation of infectious diseases in Korea annual report 2022. KDCA; 2023. Korean.
  • 22. Grabner D, Yokoyama H, Shirakashi S, et al. Diagnostic PCR assays to detect and differentiate Kudoa septempunctata, K. thyrsites and K. lateolabracis (Myxozoa, Multivalvulida) in muscle tissue of olive flounder (Paralichthys olivaceus). Aquaculture 2012;338:36−40.
  • 23. Kim JJ, Ryu S, Lee H. Foodborne illness outbreaks in Gyeonggi Province, Korea, following seafood consumption potentially caused by Kudoa septempunctata between 2015 and 2016. Osong Public Health Res Perspect 2018;9:66−72.
  • 24. An J, Jung EJ, Lee SO, et al. The association between the consumption of raw Kudoa septempunctata-infected farmed Paralichthys olivaceus and gastrointestinal symptoms. Epidemiol Health 2026 Jan 19 [Epub]. https://doi.org/10.4178/epih.e2026003.
  • 25. Yahata Y, Sugita-Konishi Y, Ohnishi T, et al. Kudoa septempunctata-induced gastroenteritis in humans after flounder consumption in Japan: a case-controlled study. Jpn J Infect Dis 2015;68:119−23.
  • 26. Korea Maritime Institute (KMI) (KR). Seafood consumption information (olive flounder) [Internet]. KMI; 2022 [cited 2025 Apr 15]. Available from: https://www.kmi.re.kr. Korean.
  • 27. de Buron I, Hill-Spanik KM, Haselden L, et al. Infection dynamics of Kudoa inornata (Cnidaria: Myxosporea) in spotted seatrout Cynoscion nebulosus (Teleostei: Sciaenidae). Dis Aquat Organ 2017;127:29−40.
  • 28. Moran JD, Kent ML, Whitaker DJ. Kudoa thyrsites (Myxozoa: Myxosporea) infections in pen‐reared Atlantic salmon in the Northeast Pacific Ocean with a survey of potential nonsalmonid reservoir hosts. J Aquat Anim Health 1999;11:101−9.
  • 29. Ishimaru K, Matsuura T, Tsunemoto K, et al. Seasonal monitoring of Kudoa yasunagai from sea water and aquaculture water using quantitative PCR. Dis Aquat Organ 2014;108:45−52.
  • 30. Shamsi S, Barton DP. Exploring the potential role of the genus Kudoa (Myxosporea: Kudoidae) as an emerging seafood-borne parasite in humans. Curr Clin Microbiol Rep 2024;11:107−14.
  • 31. Dorny P, Praet N, Deckers N, et al. Emerging food-borne parasites. Vet Parasitol 2009;163:196−206.
  • 32. Nichols GL. Food-borne protozoa. Br Med Bull 2000;56:209−35.
  • 33. Dawson D. Foodborne protozoan parasites. Int J Food Microbiol 2005;103:207−27.
  • 34. Hong SH, Kwon JY, Lee SO, et al. Kudoa septempunctata spores cause acute gastroenteric symptoms in mouse and musk shrew models as evidenced in vitro in human colon cells. Pathogens 2023;12:739.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Molecular and genetic characterization of Kudoa septempunctata from foodborne outbreaks in the Republic of Korea, 2016–2024: a retrospective public-health surveillance investigation
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Molecular and genetic characterization of Kudoa septempunctata from foodborne outbreaks in the Republic of Korea, 2016–2024: a retrospective public-health surveillance investigation
Close

Figure