Skip to contents Skip to Global Navigation Menu
  • KDCA
  • Contact us
  • E-Submission

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS. pISSN: 2210-9099. eISSN: 2233-6052
Original Article

Genetic profiling of the tolC component of the acrAB-TolC efflux pump in clinical Klebsiella pneumoniae isolates: a cross-sectional study in Pontianak, Indonesia


Published online: April 20, 2026

1Department of Microbiology, Faculty of Medicine, Universitas Tanjungpura, Pontianak, Indonesia

2Universitas Tanjungpura Hospital, Pontianak, Indonesia

3Department of Biology and Pathobiology, Faculty of Medicine, Universitas Tanjungpura, Pontianak, Indonesia

4Doctor Soedarso Regional General Hospital, Pontianak, Indonesia

Corresponding author: Mardhia Mardhia Department of Microbiology, Faculty of Medicine, Universitas Tanjungpura, Prof. Hadari Nawawi Street, Pontianak, 78124, Indonesia E-mail: mardhia@medical.untan.ac.id
• Received: December 12, 2025   • Revised: February 23, 2026   • Accepted: March 9, 2026

© 2026 Korea Disease Control and Prevention Agency.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  • 491 Views
  • 22 Download
  • Objectives
    Klebsiella pneumoniae is a leading cause of hospital-acquired infections. Its increasing prevalence poses substantial challenges to both hospital and public health systems due to the emergence of multidrug-resistant strains. Understanding the epidemiology of K. pneumoniae and its antimicrobial resistance characteristics may support antimicrobial stewardship and infection control programs. A cross-sectional study was conducted from June to November 2025.
  • Methods
    A total of 62 isolates underwent phenotypic identification and antimicrobial susceptibility testing using the BD Phoenix system (Becton Dickinson), followed by molecular detection of K. pneumoniae and efflux pump genes. Sanger sequencing was performed on isolates positive for the tolC gene.
  • Results
    Among the isolates, 66.1% were classified as extended-spectrum β-lactamase (ESBL) producers, 6.5% as carbapenem-resistant Enterobacterales (CRE), and 6.5% as both ESBL and CRE producers. Most clinical isolates were resistant to ampicillin, cefazolin, ceftazidime, ceftriaxone, ciprofloxacin, and cefepime. The acrAB and tolC genes were detected in all 62 isolates. One isolate showed a genetic profile similar to that of the K. pneumoniae KP 52.145 strain.
  • Conclusion
    This study demonstrated a high prevalence of antibiotic resistance among K. pneumoniae isolates and confirmed the presence of efflux pump genes, including tolC, with observable genetic variability. Further investigation of tolC gene evolution is essential, as these genes play critical roles in antibiotic resistance mechanisms.
Klebsiella pneumoniae is an opportunistic Gram-negative pathogen commonly found in the bloodstream, respiratory tract, and urinary tract. It can cause bloodstream infections, pneumonia, and urinary tract infections and is a frequent cause of healthcare-associated infections [14]. Over the past 3 decades, the emergence of antibiotic-resistant K. pneumoniae has increased substantially and has been associated with more invasive disease and higher mortality rates [3,5]. K. pneumoniae is known to exhibit resistance to several antibiotic classes, including penicillins, cephalosporins, and quinolones [3]. Antibiotic resistance can arise through multiple mechanisms, including point mutations in target proteins, production of β-lactamases, and multidrug resistance mediated by the overexpression of efflux pumps [6,7].
In Gram-negative bacteria, the resistance–nodulation–division (RND) superfamily plays a critical role in multidrug efflux systems that transport a wide range of compounds, including fatty acids, antiseptics, detergents, virulence factors, toxins, and antibiotics [8]. The acrAB-tolC system belongs to the RND family and is one of the most important multidrug efflux pump systems protecting Gram-negative bacteria against toxic compounds [8,9]. RND-type multidrug efflux pumps typically consist of 3 components: an inner membrane transporter, a periplasmic adaptor protein, and an outer membrane channel [9]. Additionally, clustered regularly interspaced short palindromic repeats (CRISPR) loci have been reported to contribute to multidrug resistance in bacteria [10]. Clinical isolates of K. pneumoniae have frequently been reported to overexpress RND-type efflux pumps, particularly acrAB and tolC, which substantially contribute to multidrug resistance [8,9]. Such overexpression may increase the risk of severe clinical outcomes, including higher morbidity and mortality [11]. Consequently, the increasing global prevalence of antimicrobial-resistant K. pneumoniae has led the World Health Organization to classify this organism as a critical priority pathogen.
Given the urgency of this issue, generating data on the presence and genetic characteristics of efflux pump genes is essential for improving our understanding of resistance patterns and supporting antimicrobial stewardship strategies. However, molecular data from low- and middle-income regions, including Indonesia, remain limited, particularly regarding efflux-mediated resistance mechanisms. These gaps highlight the need to characterize efflux pumps, especially through genomic profiling of tolC diversity in K. pneumoniae isolates. TolC is the major outer membrane efflux channel in Enterobacterales and facilitates the extrusion of a wide range of molecules exported by bacteria [12,13].
To the best of our knowledge, this study represents the first report of genomic characterization of the tolC efflux pump gene in clinical K. pneumoniae isolates from Indonesia. These findings provide region-specific molecular data on multidrug resistance mechanisms.
Study Population
A cross-sectional study was conducted from June to November 2025. A total of 70 clinical specimens from patients diagnosed with K. pneumoniae infection at Dr. Soedarso Hospital in Pontianak, West Kalimantan, Indonesia, were collected during the study period. Multiple specimens from the same patient, subcultures not consistent with the phenotypic characteristics of K. pneumoniae, and isolates negative on molecular detection were excluded. Of these, 62 isolates were included in the final data analysis.
Specimens
Samples were collected from various sources, including blood, pus, tissue swabs, tissue, sputum, central venous catheters, feces, endotracheal tubes, pharyngeal swabs, and bronchoalveolar lavage, depending on the participant’s diagnosis. All specimens were placed in sterile containers and transported to the laboratory at 4 °C within a maximum of 1 hour. The samples were processed within 2 hours of collection [14].
Phenotypic Identification
Specimens were inoculated onto blood agar (Merck, USA) and MacConkey agar (Merck, USA) and then incubated at 37 °C for 18 hours. Single colonies grown on blood agar or MacConkey agar were characterized by Gram staining to determine bacterial morphology and Gram reaction. Gram-negative rods were subsequently subjected to species identification using the BD Phoenix system (Becton Dickinson, Canada). A 0.5 McFarland bacterial suspension was prepared and inoculated into the BD identification panel according to the manufacturer’s protocol, followed by incubation at 37 °C for 18 hours. K. pneumoniae isolates with an identification probability of 80% or higher were included in the study.
Antibiotic Susceptibility Test
A 0.5 McFarland bacterial suspension was inoculated into the BD Antibiotic Susceptibility Test CPO panel and analyzed using EpiCenter ver. 6.61A (BD Diagnostic Systems). The antibiotics tested represented 11 antibiotic classes and included ampicillin, cefazolin, colistin, gentamicin, amikacin, cefepime, ertapenem, imipenem, meropenem, sulfamethoxazole-trimethoprim, ceftazidime, cefotaxime, minocycline, piperacillin-tazobactam, tigecycline, ampicillin-sulbactam, and ceftazidime-avibactam. In addition to classifying isolates as susceptible, intermediate, or resistant, the system also identified extended-spectrum β-lactamase (ESBL) production and carbapenem-resistant Enterobacterales (CRE).
Efflux Pump Gene Detection and Sequencing
Identification of the acrAB and tolC genes was performed using polymerase chain reaction (PCR). The khe gene was used as a housekeeping gene for K. pneumoniae. K. pneumoniae isolates were processed for DNA extraction according to the manufacturer’s protocol (Presto Mini gDNA Bacteria Kit; GeneAid). PCR conditions were as follows: initial denaturation at 94 °C for 5 minutes, followed by 40 cycles for khe and tolC and 35 cycles for acrAB. Each cycle consisted of denaturation at 94 °C for 1 minute, annealing for 30 seconds (acrAB, 58 °C; tolC, 51 °C; khe, 55 °C), and extension at 72 °C for 60 seconds. Final extension was performed at 72 °C for 10 minutes for khe and tolC and for 7 minutes for acrAB. PCR products were subjected to 3% agarose gel electrophoresis and visualized using a gel documentation system. Primers used to detect efflux pump and housekeeping genes are listed in Table 1 [15,16]. All isolates positive for efflux pump genes were subjected to Sanger sequencing. Sequencing results were analyzed against reference sequences from K. pneumoniae ATCC 4386 (Gene Accession CP064352), K. pneumoniae KP 52.145 (Gene Accession FO834906), and K. pneumoniae HS21886 (Gene Accession YP_005228876.1).
Data Analysis
Descriptive statistical analysis was performed to summarize specimen sources, antibiotic resistance patterns, and the presence of efflux pump-related genes. Variables were presented as frequencies and percentages. Data were entered into Microsoft Excel ver. 16.91 (Microsoft Corp.), and the results were presented in tabular form. Phylogenetic analysis and visualization were performed using MEGA ver. 12 for Macintosh and Interactive Tree of Life (iTOL).
Ethics Approval
The study was approved by the Health Research Ethics Committee of Doctor Soedarso Regional General Hospital, Pontianak, Indonesia (No: 36/RSUD/KEPK/IV/2025).
A total of 62 clinical isolates of K. pneumoniae were analyzed in this study from 70 patients clinically diagnosed with K. pneumoniae infection. The most common specimen source was sputum (19.4%), whereas tissue and pharyngeal swab specimens were the least common sources (1.6% each) (Table 2).
Phenotypic Detection of Antibiotic Resistance Characteristics
This study showed that 41 of 62 clinical isolates (66.1%) were classified as ESBL producers, whereas 4 of 62 (6.5%) were classified as CRE. An additional 4 isolates (6.5%) were identified as both ESBL and CRE, and 13 isolates (21.0%) were classified as non-resistant (Table 3). Antimicrobial resistance patterns were further characterized on the basis of antibiotic susceptibility results, as shown in Table 3. We found that 98.4% (61/62) of isolates were resistant to ampicillin. In addition, high proportions of isolates were resistant to cefazolin (90.3%, 55/62, ceftazidime (88.7%, 55/62), ceftriaxone (85.5%, 53/62), ciprofloxacin (83.9%, 52/62), and cefepime (83.9%, 52/62).
Efflux Pump Gene Detection and Sequencing
All 62 isolates (100%) were positive for the acrAB operon and tolC gene. Isolates positive for tolC were subsequently subjected to Sanger sequencing and analyzed using phylogenetic methods. The circular phylogenetic tree illustrates the genetic relatedness of the tolC gene among K. pneumoniae clinical isolates (labeled KP-xT) in comparison with the reference strains KP ATCC 43816, KP 52.145, and KP HS11286 (Figure 1). The phylogenetic tree demonstrated that the clinical isolates clustered into distinct clades. One isolate (KP-2T) showed similarity to the tolC gene sequence of the hypervirulent KP 52.145 strain, whereas the remaining clinical isolates formed separate clusters, suggesting possible local genetic variation.
Antibiotic Susceptibility Test
In this study, all K. pneumoniae isolates were obtained at Dr. Soedarso Hospital, Pontianak, from a diverse range of clinical specimen types. The antimicrobial resistance patterns observed in these isolates underscore the substantial burden posed by multidrug-resistant K. pneumoniae in the hospital setting. Nearly all isolates were resistant to ampicillin (98.4%), which is expected given the intrinsic resistance of K. pneumoniae mediated by chromosomal sulfhydryl variable (SHV) β-lactamase [17,18]. High resistance rates across first-, third-, and fourth-generation cephalosporins, ranging from 83.9% to 90.3%, further suggest a widespread presence of ESBL-producing isolates. Similar findings have been reported globally, particularly in Southeast Asia, where the prevalence of ESBL-producing organisms continues to rise [19,20].
In this study, carbapenem resistance, although less common than cephalosporin resistance, remains a significant clinical concern. Resistance to ertapenem (50.8%, 31/61), meropenem (33.9%, 21/62), and imipenem (29.0%, 18/62) may reflect the circulation of carbapenemase-producing strains or synergistic mechanisms involving ESBL production combined with porin loss. The relatively higher rate of ertapenem resistance is characteristic of porin-associated changes, whereas resistance to imipenem and meropenem may more strongly suggest carbapenemase activity. Ertapenem monoresistance, defined as resistance to ertapenem while retaining susceptibility to imipenem and meropenem, is a common phenotype in strains producing ESBLs or AmpC enzymes in combination with porin mutations, often in the absence of a carbapenemase [21,22]. These findings are consistent with regional surveillance data showing increasing carbapenem non-susceptibility among Enterobacterales in Indonesia [23]. Other reports have also highlighted a high proportion (74.6%) of carbapenem-resistant isolates among non-Enterobacterales, suggesting a broader global increase in carbapenem-resistant bacteria [24].
The β-lactam/β-lactamase inhibitor combinations tested showed variable activity. Resistance to ampicillin-sulbactam was high (77.4%), consistent with the limited efficacy of this agent against ESBL- and AmpC-producing strains. Resistance to piperacillin-tazobactam was lower (30.65%), although its clinical effectiveness in severe ESBL-associated infections remains uncertain, as highlighted by evidence from the MERINO trial demonstrating inferior outcomes compared with carbapenems [25]. Ceftazidime-avibactam showed greater activity, with 43.4% resistance, which is consistent with its retained efficacy against KPC- and OXA-48-producing strains; however, the presence of metallo-β-lactamases may explain resistance in nearly half of the isolates [26].
Resistance to non-β-lactam agents was also substantial. Fluoroquinolone resistance was high (83.9%), and trimethoprim-sulfamethoxazole resistance was also considerable (63.9%), limiting the utility of these agents for empirical therapy. These trends mirror global reports attributing fluoroquinolone resistance to plasmid-mediated qnr genes and chromosomal gyrA/parC mutations [27]. Aminoglycosides showed variable activity, with gentamicin resistance at 51.6%, whereas amikacin remained relatively active, with a resistance rate of 11.3%, consistent with its stability against most aminoglycoside-modifying enzymes [28]. These findings support amikacin as a valuable treatment option for multidrug-resistant K. pneumoniae infections.
Colistin resistance remained low (8.1%), indicating retained susceptibility despite global concerns regarding plasmid-mediated mcr genes [29]. Although colistin remains a last-resort therapy for carbapenem-resistant strains, the relatively low resistance observed in this study suggests that it may still have clinical utility, provided that it is used cautiously to minimize nephrotoxicity and limit further resistance emergence.
Overall, the resistance profile identified in this study reflects the broader challenges posed by multidrug-resistant K. pneumoniae worldwide. The high prevalence of cephalosporin and fluoroquinolone resistance, together with notable carbapenem resistance, substantially limits available therapeutic options.
Genetic Profiling
Our study showed that all 62 clinical isolates were positive for the acrAB operon and tolC gene. The detection rates of the acrAB operon and tolC in this study suggest that the acrAB-tolC system is a dominant efflux mechanism associated with multidrug resistance. These findings are consistent with our previous study and with recent reports showing high detection rates of these genes in clinical isolates [7,8,30]. acrAB and tolC are part of the RND superfamily, which is associated with antibiotic resistance and also contributes to environmental adaptation, pathogenicity, and biofilm formation [12]. Notably, isolates harboring these genes may export several classes of antibiotics, including β-lactams, macrolides, fluoroquinolones, and tetracyclines [31]. This observation is consistent with our findings, in which most K. pneumoniae isolates showed high resistance to β-lactams and fluoroquinolones (Table 3). However, gene expression analysis was not performed, which should be considered a limitation of this study.
The importance of this study lies in the sequencing of tolC, which revealed genetic variation among clinical K. pneumoniae isolates. The phylogenetic tree showed several major clusters, indicating genetic diversity in the tolC gene sequences across the isolates. Sequence comparisons demonstrated nucleotide variation among isolates relative to the reference strains. However, comprehensive single-nucleotide polymorphism and mutation analyses were not performed and should be recognized as a limitation of this study.
Isolate KP-38T clustered closely with the KP ATCC 43816 reference strain, suggesting genetic similarity between them (Figure 1). This finding may indicate that they share a relatively recent common ancestor, as reflected by the short branch length in the phylogenetic tree. KP-2T showed an identical tolC sequence to that of the reference strain KP 52.145 (Figure 1). K. pneumoniae strain 52.145 originated in Indonesia and was isolated in 1935. The KP 52.145 strain is considered a hypervirulent K. pneumoniae strain and is frequently used in comparative studies of virulence factor detection in K. pneumoniae [32]. The phylogenetic tree further showed that KP-2T clustered closely with the hypervirulent reference strain KP 52.145, suggesting the presence of shared genetic features potentially related to virulence. This clinical isolate was obtained from sputum and was resistant to ampicillin, ampicillin-sulbactam, cefazolin, cefepime, ceftazidime, ceftriaxone, and ciprofloxacin and was identified as an ESBL producer. Hypervirulent K. pneumoniae strains possess plasmids encoding genetic factors that enable evasion of host immune defenses and the development of severe infections [33]. We also compared our sequencing results with those of the KP HS21886 strain. K. pneumoniae KP HS21886 is a multidrug-resistant strain primarily resistant to carbapenems. In our study, no clinical isolates clustered with KP HS21886 (Figure 1), despite the detection of 4 CRE isolates. However, this finding does not exclude the possibility that some isolates may share antimicrobial resistance mechanisms with KP HS21886.
Phylogenetic analysis of tolC among the clinical K. pneumoniae isolates revealed substantial genetic diversity. The reference strains were distributed across different clusters. This variability may indicate that the clinical isolates included in this study were derived from multiple ancestral lineages rather than from a single clonal population. This interpretation is consistent with the known genomic plasticity of K. pneumoniae. K. pneumoniae is recognized as a pathogen capable of adapting to diverse environments, largely because its genomic plasticity facilitates the acquisition and dissemination of antimicrobial resistance determinants through plasmids and other mobile genetic elements [34,35].
Because tolC is associated with efflux pump activity that contributes to antibiotic resistance, genetic variation in this gene may be associated with differences in phenotypic resistance profiles. In the phylogenetic tree, branch length reflects relatedness within subclusters, and longer branches may indicate greater sequence divergence in tolC. The observed diversity supports the need for ongoing molecular surveillance to identify emerging lineages of potential clinical importance [36].
This study provides the first report of tolC sequencing in clinical K. pneumoniae isolates from Indonesia and highlights this gene as an important component associated with efflux pump mechanisms. Understanding tolC gene evolution is important because this gene may contribute to antibiotic resistance mechanisms and may have implications for antimicrobial stewardship and the development of future therapeutic strategies. Further studies examining the functional and genomic variation of tolC are needed to clarify its role in multidrug resistance and its epidemiological significance.
• The tolC gene was detected in all clinical Klebsiella pneumoniae isolates, indicating its widespread distribution.
• Sequence analysis revealed genetic variation in the tolC among the isolates, suggesting molecular diversity.
• Phylogenetic analysis highlights that isolate KP-2T shares sequence similarity with the hypervirulent reference strain KP 52.145 and isolate KP-38T with ATCC 43816.
• These findings highlight the potential contribution of the tolC-associated efflux system to antimicrobial resistance and warrant further surveillance.

Ethics Approval

This study was approved by the Institutional Review Board of Doctor Soedarso Regional General Hospital, Pontianak, Indonesia (No: 36/RSUD/KEPK/IV/2025) and performed in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained for publication of this study and accompanying images.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Funding

This study was supported in part by a grant from the Ministry of Higher Education, Science, and Technology, Indonesia, under the Fundamental Research program (No. 115/C3/DT.05.00/PL/2025).

Availability of Data

All data generated or analyzed during this study are included in this published article. For other data, these may be requested through the corresponding author.

Authors’ Contributions

Conceptualization: MMar, SEP, DFL; Data curation: MMar, MMah, RA; Formal analysis: MMar; Funding acquisition: MMar, SEP, DFL; Investigation: MMar, DFL, SEP, MMah, RA; Methodology: MMar, MMah; Project administration: MMar; Resources: MMar, SEP, DFL, MMah, RA; Software: MMah; Supervision: DFL; Validation: SEP; Visualization: MMar; Writing–original draft: MMar; Writing–review & editing: all authors. All authors read and approved the final manuscript.

Figure 1.
Phylogenetic tree. KP-xT: samples; Klebsiella pneumoniae reference using KP ATCC 43816, KP 52.145, and KP HS11286.
Figure 1. Phylogenetic tree. KP-xT: samples; Klebsiella pneumoniae reference using KP ATCC 43816, KP 52.145, and KP HS11286.
	 
Table 1.
Primer sequences used for the target genes
Table 1.
Target gene Primer sequence (5’ to 3’) Amplicon size (bp) Reference
khe F TGATTGCATTCGCCACTGG 428 [16]
R GGTCAACCCAACGATCCTGG
acrAB F ATCAGCGGCCGGATTGGTAAA 312 [15]
R CGGGTTCGGGAAAATAGCGCG
tolC F ATCAGCAACCCCGATCTGCGT 527 [15]
R CCGGTGACTTGACGCAGTCCT
Table 2.
Specimen source of Klebsiella pneumoniae clinical isolates (n=62)
Table 2.
Specimen Frequency (%)
Blood 10 (16.1)
Endotracheal tube 10 (16.1)
Tissue swab 7 (11.3)
Sputum 12 (19.4)
Bronchoalveolar lavage 11 (17.7)
Pus 5 (8.1)
Central venous catheter 3 (4.8)
Feces 2 (3.2)
Tissue 1 (1.6)
Pharyngeal swab 1 (1.6)
Table 3.
Resistance pattern of Klebsiella pneumoniae clinical isolates by BD antibiotic susceptibility method (n=62)
Table 3.
Resistance frequency (n/isolates, %)a)
Antibiotics
 Penicillin
  Ampicillin 61/62 (98.4)
 Cephalosporin (first generation)
  Cefazolin 55/62 (90.3)
 Cephalosporin (third generation)
  Ceftriaxone 53/61 (86.9)
  Ceftazidime 55/62 (88.7)
 Cephalosporin (fourth generation)
  Cefepime 52/62 (83.9)
 Carbapenem
  Ertapenem 31/61 (50.8)
  Imipenem 18/62 (29.03)
  Meropenem 21/61 (34.4)
 Beta-lactam and anti-beta lactamase
  Piperacillin-tazobactam 19/62 (30.6)
  Ceftazidime-avibactam 26/60 (43.3)
  Ampicillin-sulbactam 48/62 (77.4)
 Tetracycline (30 S)
  Minocycline 25/61 (41.0)
 Fluoroquinolone
  Ciprofloxacin 52/62 (83.9)
 Sulfonamide and DHFR inhibitors
  Sulfamethoxazole-trimethoprim 39/61 (63.9)
 Aminoglycoside (30 S)
  Gentamicin 32/62 (51.6)
  Amikacin 7/62 (11.3)
 Polymyxin
  Colistin 5/62 (8.1)
Drug resistance classification
 ESBL 41 (66.1)
 CRE 4 (6.5)
 ESBL+CRE 4 (6.5)
 Not Detected 13 (21.0)

DHFR, dihydrofolate reductase; ESBL, extended-spectrum β-lactamase; CRE, carbapenem-resistant Enterobacterales.

a)Intermediate results are not included.

  • 1. Ballén V, Gabasa Y, Ratia C, et al. Antibiotic resistance and virulence profiles of Klebsiella pneumoniae strains isolated from different clinical sources. Front Cell Infect Microbiol 2021;11:738223.
  • 2. Chang D, Sharma L, Dela Cruz CS, et al. Clinical epidemiology, risk factors, and control strategies of Klebsiella pneumoniae Infection. Front Microbiol 2021;12:750662.
  • 3. Muraya A, Kyany'a C, Kiyaga S, et al. Antimicrobial resistance and virulence characteristics of Klebsiella pneumoniae isolates in kenya by whole-genome sequencing. Pathogens 2022;11:545.
  • 4. Al-Ouqaili MT. Molecular detection of medically important carbapenemases genes expressed by metallo-β-lactamase producer isolates of pseudomonas aeruginosa and Klebsiella pneumoniae. Asian J Pharm 2018;12:1−11.
  • 5. Kaza P, Xavier BB, Mahindroo J, et al. Extensively drug-resistant klebsiella pneumoniae associated with complicated urinary tract infection in northern India. Jpn J Infect Dis 2024;77:7−15.
  • 6. Vieira Da Cruz A, Jimenez-Castellanos JC, Bornsen C, et al. Pyridylpiperazine efflux pump inhibitor boosts in vivo antibiotic efficacy against K. pneumoniae. EMBO Mol Med 2024;16:93−111.
  • 7. Hussein RA, Al-Kubaisy SH, Al-Ouqaili MT. The influence of efflux pump, outer membrane permeability and β-lactamase production on the resistance profile of multi, extensively and pandrug resistant Klebsiella pneumoniae. J Infect Public Health 2024;17:102544.
  • 8. Mardhia M, Liana DF, Mahyarudin M, et al. The first report of antibiotic resistance and virulence factor profiles in multidrug-resistant clinical isolates of Klebsiella pneumoniae from Pontianak, Indonesia. Osong Public Health Res Perspect 2025;16:160−8.
  • 9. Ni RT, Onishi M, Mizusawa M, et al. The role of RND-type efflux pumps in multidrug-resistant mutants of Klebsiella pneumoniae. Sci Rep 2020;10:10876.
  • 10. Al-Ouqaili MT, Jameel NQ, Sabri MM. The occurrence of CRISPR-encoding genes in extensively drug-resistant Escherichia coli causing urinary tract infection. Al-Anbar Med J 2025;21:223−9.
  • 11. Bina XR, Weng Y, Budnick J, et al. Klebsiella pneumoniae TolC contributes to antimicrobial resistance, exopolysaccharide production, and virulence. Infect Immun 2023;91:e0030323.
  • 12. Jang S. AcrAB-TolC, a major efflux pump in Gram negative bacteria: toward understanding its operation mechanism. BMB Rep 2023;56:326−34.
  • 13. Iyer R, Moussa SH, Tommasi R, et al. Role of the Klebsiella pneumoniae TolC porin in antibiotic efflux. Res Microbiol 2019;170:112−6.
  • 14. Leber AL. Clinical microbiology procedures handbook. 4th ed. American Society for Microbiology Press; 2016.
  • 15. Mirzaie A, Ranjbar R. Antibiotic resistance, virulence-associated genes analysis and molecular typing of Klebsiella pneumoniae strains recovered from clinical samples. AMB Express 2021;11:122.
  • 16. Al-Aajem BM, Jasim HM, Saleem AJ. Detection of Virulent genes Khe, iuc, rmp, magA in Klebsiella pneumoniae isolated from urinary tract infection. Int J Drug Deliv Technol 2021;11:1470−3.
  • 17. Wyres KL, Holt KE. Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr Opin Microbiol 2018;45:131−9.
  • 18. Al-Ouqaili MT. Molecular detection and sequencing of SHV gene encoding for extended-spectrum β-lactamases produced by multidrug resistance some of the Gram-negative bacteria. Int J Green Pharm 2018;12:S910−8.
  • 19. Bevan ER, Jones AM, Hawkey PM. Global epidemiology of CTX-M β-lactamases: temporal and geographical shifts in genotype. J Antimicrob Chemother 2017;72:2145−55.
  • 20. Sunarno S, Puspandari N, Fitriana F, et al. Extended spectrum beta lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae in Indonesia and South East Asian countries: GLASS data 2018. AIMS Microbiol 2023;9:218−27.
  • 21. Jaramillo Cartagena A, Taylor KL, Lopez LC, et al. The carbapenem inoculum effect provides insights into the molecular mechanisms underlying carbapenem resistance in the Enterobacterales. mBio 2025;16:e0154025.
  • 22. Wang Y, Hu H, Shi Q, et al. Prevalence and characteristics of ertapenem-mono-resistant isolates among carbapenem-resistant Enterobacterales in China. Emerg Microbes Infect 2024;13:2332658.
  • 23. Indonesian Society for Clinical Microbiology (ISCM) (ID). Indonesian antibiotic resistance report 2024: pathogen patterns and antibiograms [Internet]. ISCM; 2025 [cited 2025 Dec 12]. https://sinar.pamki.or.id/2025/11/28/buku-sinar-pamki-2025-data-resistensi-antibiotik-indonesia-tahun-2024/.
  • 24. Al-Ouqaili MT, Hussein RA, Kanaan BA, et al. Investigation of carbapenemase-encoding genes in Burkholderia cepacia and Aeromonas sobria isolates from nosocomial infections in Iraqi patients. PLoS One 2025;20:e0315490.
  • 25. Harris PN, Tambyah PA, Lye DC, et al. Effect of piperacillin-tazobactam vs meropenem on 30-day mortality for patients with E coli or Klebsiella pneumoniae bloodstream infection and ceftriaxone resistance: a randomized clinical trial. JAMA 2018;320:984−94.
  • 26. Shields RK, Chen L, Cheng S, et al. Emergence of ceftazidime-avibactam resistance due to plasmid-borne blaKPC-3 mutations during treatment of carbapenem-resistant Klebsiella pneumoniae infections. Antimicrob Agents Chemother 2017;61:e02097−16.
  • 27. Hooper DC, Jacoby GA. Mechanisms of drug resistance: quinolone resistance. Ann N Y Acad Sci 2015;1354:12−31.
  • 28. Krause KM, Serio AW, Kane TR, et al. Aminoglycosides: an overview. Cold Spring Harb Perspect Med 2016;6:a027029.
  • 29. Liu YY, Wang Y, Walsh TR, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 2016;16:161−8.
  • 30. Swedan SF, Aldakhily DB. Antimicrobial resistance, biofilm formation, and molecular detection of efflux pump and biofilm genes among Klebsiella pneumoniae clinical isolates from Northern Jordan. Heliyon 2024;10:e34370.
  • 31. Huy TX. Overcoming Klebsiella pneumoniae antibiotic resistance: new insights into mechanisms and drug discovery. Beni Suef Univ J Basic Appl Sci 2024;13:13.
  • 32. Rodrigues C, d'Humieres C, Papin G, et al. Community-acquired infection caused by the uncommon hypervirulent Klebsiella pneumoniae ST66-K2 lineage. Microb Genom 2020;6:mgen000419.
  • 33. Choby JE, Howard-Anderson J, Weiss DS. Hypervirulent Klebsiella pneumoniae: clinical and molecular perspectives. J Intern Med 2020;287:283−300.
  • 34. Bahati SY, Maghembe RS. Pangenome analysis of Tanzanian clinical Klebsiella pneumoniae reveals pandemic clones with high genome plasticity and versatile mobilome, virulome, and resistome profiles. Microbiol Spectr 2025;13:e0194725.
  • 35. Rolbiecki D, Kiedrzynska E, Czatzkowska M, et al. Global dissemination of Klebsiella pneumoniae in surface waters: genomic insights into drug resistance, virulence, and clinical relevance. Drug Resist Updat 2025;79:101204.
  • 36. Kantarcioglu I, Gaszek IK, Guclu TF, et al. Structural shifts in TolC facilitate efflux-mediated β-lactam resistance. Commun Biol 2024;7:1051.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genetic profiling of the tolC component of the acrAB-TolC efflux pump in clinical Klebsiella pneumoniae isolates: a cross-sectional study in Pontianak, Indonesia
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genetic profiling of the tolC component of the acrAB-TolC efflux pump in clinical Klebsiella pneumoniae isolates: a cross-sectional study in Pontianak, Indonesia
Close

Figure