Skip to contents Skip to Global Navigation Menu
  • KDCA
  • Contact us
  • E-Submission

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS. pISSN: 2210-9099. eISSN: 2233-6052
Original Article

The first report of antibiotic resistance and virulence factor profiles in multidrug-resistant clinical isolates of Klebsiella pneumoniae from Pontianak, Indonesia

Osong Public Health and Research Perspectives 2025;16(2):160-168.
Published online: April 4, 2025

1Department of Microbiology, Faculty of Medicine, Universitas Tanjungpura, Pontianak, Indonesia

2Universitas Tanjungpura Hospital, Pontianak, Indonesia

3Department of Pharmacy, Faculty of Medicine, Universitas Tanjungpura, Pontianak, Indonesia

Corresponding author: Mardhia Mardhia Department of Microbiology, Faculty of Medicine, Universitas Tanjungpura, Prof. Hadari Nawawi Street, Pontianak 78124, Indonesia E-mail: mardhia@medical.untan.ac.id
• Received: August 31, 2024   • Revised: December 29, 2024   • Accepted: January 23, 2025

© 2025 Korea Disease Control and Prevention Agency.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  • 3,385 Views
  • 118 Download
  • 1 Crossref
  • 1 Scopus
prev next
  • Objectives
    Klebsiella pneumoniae is known as one of the most common causes of hospital-acquired infections. Its prevalence poses substantial challenges to both hospital and public health systems, particularly due to the rise of multidrug‐resistant strains. Understanding the epidemiology and resistance properties of K. pneumoniae can inform antimicrobial stewardship and infection control programs. A cross-sectional study was employed from November 2021 to November 2023.
  • Methods
    A total of 24 isolates underwent antimicrobial susceptibility testing using the disk diffusion method, an extended-spectrum beta-lactamase (ESBL) production test, and molecular gene detection.
  • Results
    The study found that 95.8% of clinical isolates were classified as multidrug-resistant. All isolates were resistant to ampicillin (100%). A high percentage of isolates were resistant to cefazolin (91.7%), ceftriaxone (87.5%), cefotaxime (87.5%), cefepime (87.5%), ciprofloxacin (83.3%), and sulfamethoxazole-trimethoprim (83.3%). Of the 24 isolates, 87.5% harbored ESBL genes, while the frequencies for GES, NDM, SIM, and OXA-48 were 16.7%, 20.8%, 8.3%, and 41.7%, respectively. Notably, the OXA-23 and OXA-51 genes, which are typically associated with Acinetobacter baumannii, were detected in 16.7% and 20.8% of isolates, respectively. Moreover, the prevalence of virulence genes rmpA, acrAB, and tolC was 0%, 95.8%, and 87.5%, respectively.
  • Conclusion
    This study demonstrated a high level of antibiotic resistance and a significant presence of virulence genes among K. pneumoniae isolates. Consequently, these findings represent a critical public health issue that requires heightened awareness among all stakeholders, including health workers.
Klebsiella pneumoniae is an opportunistic pathogen found in the blood, respiratory, and urinary tracts and is a common cause of bloodstream infections, pneumonia, and urinary tract infections; it is also considered a frequent cause of healthcare-associated infections [1,2]. The emergence of hypervirulent K. pneumoniae infections has been on the rise and has been associated with invasive diseases and increasing mortality over the past 3 decades [3]. The prevalence of K. pneumoniae infections ranges from 18% to 87.7% in Asian countries, whereas in Western countries it varies from 5% to 35% [2,4]. The mortality rate for bloodstream infections caused by K. pneumoniae is approximately 43.0% [5]. Indonesian surveillance data on hospital antibiotic resistance indicate that K. pneumoniae is the most frequently isolated bacterium from blood and sputum samples, and the second most frequently isolated from urine specimens, with an infection incidence of 14% [6].
Susceptible strains of K. pneumoniae are commonly eradicated by broad-spectrum β-lactams (with the exception of ampicillin and ticarcillin), carbapenems, trimethoprim-sulfamethoxazole, tetracycline, aminoglycosides, and fluoroquinolones [7]. However, treatment becomes more challenging due to plasmid-mediated antimicrobial resistance [8,9]. According to the Global Antimicrobial Resistance and Surveillance System on Emerging Antimicrobial Resistance Reporting data from 2024, hypervirulent, carbapenem-resistant K. pneumoniae is on the rise [10]. European countries have reported an increasing detection of hypervirulent K. pneumoniae that combines antibiotic resistance, with some isolates being extensively drug-resistant (XDR) [11]. Surveillance in South and Southeast Asia has revealed that 47% of isolates are extended-spectrum beta-lactamase (ESBL) producers and 17% are carbapenemase producers [12]. Additionally, reports from Baghdad indicate that quinolone resistance in K. pneumoniae is high [13]. K. pneumoniae has thus emerged as a significant challenge in hospital settings and public health, primarily due to the increasing incidence of infections caused by multidrug-resistant (MDR) strains. However, the prevalence of antibiotic resistance and virulence genes among pathogenic K. pneumoniae has yet to be investigated in West Kalimantan, Indonesia. Therefore, this study aimed to evaluate the incidence of K. pneumoniae infections and their antibiotic resistance properties, including virulence genes, in Pontianak, Indonesia.
Study Population
A cross-sectional study was conducted from November 2021 to November 2023. A total of 154 clinical specimens from patients diagnosed with infections at 5 hospitals in Pontianak, West Kalimantan, Indonesia, were examined. Twenty-5 isolates confirmed as K. pneumoniae were initially collected; however, 24 isolates were ultimately included in the final analysis.
Specimens
Specimens were collected from feces, urine, sputum, pus, wound swabs, vitreous humor, ear/nose secretions, and bronchoalveolar lavage (BAL) according to the participants' diagnoses. All specimens were stored in sterile containers and transported to the laboratory at 4 °C. Samples were processed within 2 hours of collection.
Phenotypic Identification
Specimens were inoculated on blood agar (Merck, USA) and MacConkey agar (Merck, USA), and then incubated at 37 °C for 18 hours. Single colonies from both media were subjected to Gram staining to determine bacterial shape and Gram reaction. Gram-negative rods were further identified to the species level using an oxidase test (Merck, USA) and API 20E (Biomerieux). A 0.5 McFarland bacterial suspension was prepared and used in accordance with the API 20E protocol, followed by incubation at 37 °C for 18 hours. Identification results were validated using https://apiweb.biomerieux.com, and only K. pneumoniae isolates with an identification percentage of ≥80% were included in the study.
Antibiotic Susceptibility Test by Disk Diffusion Method
A 0.5 McFarland bacterial suspension was prepared and inoculated onto Mueller Hinton agar (Merck, USA) using a sterile cotton swab for the antibiotic susceptibility test by the disk diffusion method. Fourteen representative antibiotics from different classes were tested, including ampicillin (AMP, 10 µg; Oxoid), cefazolin (KZ, 30 µg; Oxoid), gentamicin (CN, 10 µg; Oxoid), tobramycin (NN, 10 µg; BD BBL), amikacin (AK, 30 µg; Oxoid), amoxicillin-clavulanate (AMC, 30 µg; Oxoid), cefepime (FEP, 30 µg; Oxoid), ceftriaxone (CRO, 30 µg; Oxoid), ciprofloxacin (CIP, 5 µg; Oxoid), levofloxacin (LEV, 5 µg; Oxoid), meropenem (MEM, 10 µg; Oxoid), sulfamethoxazole-trimethoprim (SXT, 25 µg; Oxoid), aztreonam (ATM, 30 µg; Oxoid), ceftazidime (CAZ, 30 µg; Oxoid), cefotaxime (CTX, 30 µg; Oxoid), tetracycline (TE, 30 µg; Oxoid), chloramphenicol (C, 30 µg; Oxoid), and azithromycin (AZM, 15 µg; Oxoid). Plates were incubated at 37 °C for 18 hours. The inhibition zones were interpreted according to the Clinical and Laboratory Standard Institute (CLSI) guidelines [14]. The results were then used to classify the bacteria as MDR, XDR, or pan-drug-resistant (PDR) [15].
Screening and Confirmation of ESBL-Producing Isolates
Phenotypic detection of ESBL-producing isolates was performed using the disk diffusion method with amoxicillin-clavulanate (AMC, 30 µg; Oxoid) in conjunction with cefotaxime (CTX, 30 µg; Oxoid) and ceftazidime (CAZ, 30 µg; Oxoid). A 0.5 McFarland isolate suspension was inoculated onto Mueller Hinton agar (Merck, Germany) using a sterile cotton swab. The cefotaxime and ceftazidime disks were placed side by side with the amoxicillin-clavulanate disk, at a distance of 20 mm from the disk center. Plates were then incubated at 37 °C for 16 to 18 hours. An increase in the inhibition zone diameter of more than 5 mm towards the amoxicillin-clavulanate disk compared to the zones for cefotaxime and/or ceftazidime was considered indicative of ESBL production [14,16].
Bacterial DNA Extraction and Identification
A single colony from each bacterial isolate was suspended in 1 mL of nuclease-free water (NFW) and then centrifuged at 13,000 rpm for 10 minutes. The resulting pellet was resuspended in 200 µL of NFW, and DNA was extracted according to the manufacturer’s protocol (Presto Mini gDNA bacteria kit; GeneAid). Molecular identification of K. pneumoniae was performed using the khe gene, which also serves as a housekeeping gene in virulence gene detection. Identification via the khe gene was conducted using real-time polymerase chain reaction (PCR) on an Applied Biosystems Quant Studio 5 Real-Time PCR System. The PCR reaction was carried out in a total volume of 20 μL, consisting of 2X Fast Q-PCR Master Mix (SMOBIO Technology), 0.6 μL (10 μM) of each primer, 2 μL of DNA template, and NFW. The PCR conditions were as follows: an initial denaturation at 94 °C for 5 minutes, followed by 33 cycles of 1 minute at 94 °C for denaturation, 30 seconds at 55 °C for annealing, and 60 seconds for extension, with a final extension at 72 °C for 10 minutes. The primers for the khe gene are listed in Table 1 [1619].
Antibiotic Resistance Gene Detection
Antibiotic resistance gene detection was performed using the Antimicrobial Resistance (AMR) Direct Flow Chip Kit (Vitro, Spain). A DNA template of 80 µL was used in the AMR Direct Sepsis Flow Chip Kit PCR protocol. Thermal cycling was carried out on a Classic KF960 Thermal Cycler (Heal Force) with an initial step at 25 °C for 10 minutes, followed by 95 °C for 3 minutes, and then 40 amplification cycles at 95 °C for 15 seconds, 55 °C for 45 seconds, and 72 °C for 1 minute, with a final elongation at 72 °C for 7 minutes. The PCR products were then subjected to a hybridization process on the HybriSpot 12 system (Vitro) following the manufacturer’s protocol. After hybridization, the results were captured and analyzed using HybriSoft software ver. HSHS 2.2.0.R11. Resistance genes with a spot thickness of ≥4 were considered positive. The probes targeted for K. pneumoniae included SHV, CTX-M, KPC, SME, NMC/IMI, GES, VIM, GIM, SPM, NDM, SIM, IMP, OXA-23, OXA-24, OXA-48, OXA-51, and OXA-58 [18].
Virulence Gene Detection
Identification of the rmpA, acrAB, and tolC genes was performed using real-time PCR on an Applied Biosystems Quant Studio 5 Real-Time PCR System. The PCR reaction was carried out in a total volume of 20 μL, which included 2X Fast Q-PCR Master Mix, 0.6 μL (10 μM) of each primer, 2 μL of DNA template, and NFW. The PCR conditions were as follows: an initial denaturation at 94 °C for 5 minutes, followed by 33 cycles of 1 minute at 94°C for denaturation, 30 seconds for annealing (with specific temperatures: rmpA at 55 °C, acrAB at 53 °C, and tolC at 51 °C), and 60 seconds for extension, with a final extension at 72 °C for 10 minutes. The primers used for virulence gene detection are listed in Table 1 [19,20].
Data Analysis
Data were entered into Microsoft Excel for analysis, and the results were presented in tabular form.
Ethics Statement
The study protocol was approved by the Health Research Ethics Committee of the Faculty of Medicine at Universitas Tanjungpura, Pontianak, Indonesia (approval number: 5949/UN22.9/PG/2021).
A total of 24 clinical samples of K. pneumoniae were obtained from 154 patients with clinically diagnosed infections. The most common sources of specimens were sputum (80%), followed by BAL fluid (9%), urine (5%), wound swabs/discharge (4%), and feces (2%).
Phenotypic Detection of Antibiotic Resistance Characteristic
This study found that 23 out of 24 (95.8%) clinical isolates were classified as MDR, while 1 out of 24 (4.2%) exhibited PDR; no XDR isolates were identified (Table 2). The antimicrobial resistance profiles of the isolates, as classified based on their antibiotic resistance results, are presented in Table 2. All isolates were resistant to ampicillin (100%, 24/24). Furthermore, a high percentage of isolates were resistant to cefazolin (91.7%, 22/24), ceftriaxone (87.5%, 21/24), cefotaxime (87.5%, 21/24), cefepime (87.5%, 21/24), ciprofloxacin (83.3%, 20/24), and sulfamethoxazole-trimethoprim (83.3%, 20/24).
Among the 24 isolates, 5 (20.8%) were classified as ESBL-producing K. pneumoniae based on the phenotypic ESBL test. Fifteen isolates (62.5%) demonstrated resistance to ceftazidime, amoxicillin-clavulanate, and cefotaxime, which resulted in the absence of any distortion or increase in the inhibition zone towards the amoxicillin-clavulanate disk. ESBL-producing K. pneumoniae, as identified by the ESBL test, are illustrated in Figure 1.
Molecular Detection of Antibiotic Resistance and Virulence Associated Genes
Molecular detection for ESBL genes, specifically CTX-M and SHV, demonstrated that 14 (58.3%) clinical isolates were positive for these ESBL genes, while 3 (12.5%) isolates were negative. The majority of isolates (41.7%) harbored the OXA-48 gene. Notably, the less common resistance genes, OXA-23 and OXA-51, were detected in 4 (16.7%) and 5 (20.8%) isolates, respectively. These genes encode carbapenemases that confer decreased susceptibility to carbapenems, notably meropenem and imipenem [21]. Additionally, all isolates predominantly harbored the virulence genes acrAB and tolC at rates of 95.8% and 87.5%, respectively. Detailed data are presented in Table 3.
This is the first report describing the detection of MDR and PDR K. pneumoniae in Pontianak, Indonesia. Our findings demonstrated that the majority (95.8%, 23/24) of K. pneumoniae isolates collected from 5 different specimen types were MDR strains (Table 2). A similar pattern has been observed in studies from Iran, Saudi Arabia, and China, indicating a significant global issue with MDR K. pneumoniae [2224]. According to the first meta-analysis on nosocomial MDR K. pneumoniae, its emergence is expected to increase globally, highlighting the urgent need to improve and evaluate the use of appropriate antibiotics [25]. Infections associated with MDR K. pneumoniae can complicate treatment, prolong hospitalization, and increase medical costs, as well as mortality and morbidity rates [23]. Moreover, infections caused by MDR K. pneumoniae are linked to 22% to 72% mortality in hospitalized and immunocompromised patients [26]. Unfortunately, our study did not assess the association between MDR K. pneumoniae infections and morbidity, which is a limitation of this report.
Data presented in Table 1 indicate that most K. pneumoniae strains are MDR and PDR, with more than 75% of the 24 isolates resistant to all beta-lactam antibiotics tested, although 54.2% of isolates were susceptible to meropenem. A previous study reached a similar conclusion, noting that MDR K. pneumoniae exhibited good sensitivity only to meropenem [27]. Additionally, all isolates were resistant to ampicillin, which is consistent with a study from China that reported the majority of MDR K. pneumoniae (>90%) were resistant to penicillin G [28].
The treatment options for MDR K. pneumoniae are not well optimized [9]. However, aminoglycosides are frequently used in combination with other antibiotic classes to combat these MDR strains [9], which is consistent with our results showing that 83% of isolates were sensitive to amikacin, followed by gentamicin and tobramycin (Table 2). Our findings also confirm that the isolates exhibited high resistance to sulfamethoxazole-trimethoprim (83.3%, 20/24) and amoxicillin-clavulanate (54.2%, 13/24). This contrasts with 2 clinical studies where these antibiotics appeared promising for treating infections caused by carbapenemase- and ESBL-producing K. pneumoniae [29,30]. Tigecycline and colistin are recognized as highly effective against PDR K. pneumoniae infections; tigecycline is considered first-line therapy for PDR K. pneumoniae, while colistin serves as the last resort [31].
K. pneumoniae exhibits resistance to beta-lactam antibiotics through several mechanisms, including the enzymatic hydrolysis of carbapenems and beta-lactams by carbapenemases and ESBLs [8]. Our results indicated that 87.5% of isolates expressed ESBL genes (including CTX-M and SHV), with these genes absent in 3 of the 24 isolates (Table 3). This finding is consistent with the results reported by Beena et al. [32], who found that 84% of 250 K. pneumoniae isolates were ESBL producers. Similarly, Sheikh and colleagues reported that 65% of 120 clinical isolates were ESBL producers [33].
ESBLs can be inhibited by beta-lactamase inhibitors such as clavulanic acid. Phenotypic identification of ESBL production is typically performed using the disk diffusion method with a cephalosporin combined with a beta-lactamase inhibitor, such as ceftazidime-clavulanate or cefotaxime-clavulanate, as recommended by the CLSI guidelines. However, the phenotypic test is prone to false-negative results. Therefore, molecular gene detection is recommended as a primary method for identifying antibiotic resistance [14,34]. In Indonesia, access to the combination disks is limited; hence, amoxicillin-clavulanate was used in this study. Consequently, 19 out of 24 isolates were identified as non-ESBL producers by phenotypic testing, whereas molecular detection yielded positive results for 17 of these 19 phenotypically negative isolates. Based on our findings, the phenotypic test produced false negatives at a rate of 89.5%.
Our findings indicate that 66.67% of K. pneumoniae isolates were resistant to meropenem as determined by the disk diffusion test. Among the carbapenemase gene-resistant strains, all were ESBL-positive (13/24). In our study, 41.7% of isolates harbored the OXA-48 gene and 20.8% harbored the NDM gene. OXA-48 and NDM are well known as major contributors to carbapenem resistance in K. pneumoniae, as reported in studies from India and Ukraine [35,36]. Notably, our study detected the OXA-23 and OXA-51 genes in 16.7% and 20.8% of isolates, respectively (Table 3). These class D carbapenemases, typically found in Acinetobacter baumannii, were initially identified in A. baumannii, with OXA-23 being the first OXA enzyme detected that exhibited carbapenemase activity. Both genes can be encoded on plasmids and chromosomes [37,38]. A study from Iran reported similar findings, with OXA-51 found more frequently (30%) than OXA-23 (2.6%) [39].
OXA-23 and OXA-51 are commonly associated with ISAba1-based transposons, specifically found in AbaR4-type resistance islands and in transposons such as Tn2006, Tn2008, and Tn2009 for OXA-23 [40]. Through ISAba1-mediated transposition, these elements can be inserted into plasmids or integrated into chromosomes [40,41]. Antimicrobial resistance genes can transfer across different pathogen species or between strains via mobile genetic elements such as insertion sequences, integrons, and transposons [40]. Thus, horizontal gene transfer is considered a key mechanism in the emergence of OXA-23 and OXA-51 in K. pneumoniae. Carbapenems are widely regarded as reliable and effective antibiotics for treating severe nosocomial infections that are resistant to cephalosporins [42]. This situation warrants global attention, as it could contribute to the rise of antibiotic-resistant microorganisms and limit the availability of effective antibiotics.
Our study also examined the presence of virulence-encoding genes acrAB, tolC, and rmpA, with prevalence rates of 95.8%, 87.5%, and 0%, respectively (Table 3). The acrAB and tolC genes encode major resistance-nodulation-division (RND) efflux pumps, which are unique to Gram-negative bacteria and play a significant role in treatment outcomes. These efflux pumps are crucial for antibiotic export and contribute to the intrinsic resistance of Gram-negative bacteria. Additionally, acrAB and tolC are involved in biofilm formation, pathogenicity, and adaptation to environmental stresses [43]. These RND efflux pumps can export a wide range of substrates, including various antibiotics, bile salts, detergents, dyes, and biocides [4345]. In contrast, rmpA is recognized as a marker gene for hypervirulent K. pneumoniae strains, which are capable of causing community-acquired infections and pose a global concern due to their ability to infect healthy individuals and cause infections at multiple sites [46].
The prevalence of the acrAB and tolC genes was high in our study (Table 3), and together they constitute the primary RND efflux pump in Enterobacterales. Other studies have reported a lower prevalence of acrAB and tolC (41% and 33%, respectively) [20]. The active acrAB-tolC efflux pump can export several antibiotics, including beta-lactams, macrolides, fluoroquinolones, and tetracycline [47]. This is consistent with our findings, which show that the majority of K. pneumoniae isolates exhibited high levels of resistance to these antibiotics (Table 2). Notably, the rmpA gene was not detected in any of the K. pneumoniae isolates in this study. Since rmpA plays a crucial role in the hypervirulence of K. pneumoniae by inducing capsule production [46], its absence suggests that all the isolates in our study were non-hypervirulent strains.
To the best of our knowledge, this is the first report of K. pneumoniae data from Pontianak, Indonesia. This finding should raise awareness among health workers about the threat of antibiotic resistance in West Kalimantan. Despite the limited number of isolates in the study, the high prevalence of resistance genes among K. pneumoniae isolates signals a global threat that warrants attention from all stakeholders, including health workers. The responsible use of antibiotics, regular monitoring, and strict infection control practices are essential for reducing the spread of MDR bacteria and protecting public health. Additionally, comprehensive studies with larger sample sizes are necessary to elucidate the local epidemiology of K. pneumoniae and to inform the development of targeted interventions to combat antibiotic resistance in the region.
• Multidrug-resistant Klebsiella pneumoniae infections have been on the rise.
K. pneumoniae has emerged as a significant challenge in hospital settings and public health.
• Multidrug-resistant K. pneumoniae has been associated with invasive diseases and increasing mortality for the last 3 decades.
• Antibiotic stewardship should be implemented to curb the increase in antibiotic-resistant strains.

Ethics Approval

This study was approved by the Institutional Review Board of Faculty of Medicine of Universitas Tanjungpura, Pontianak, Indonesia (approval number: 5949/UN22.9/PG/2021) and performed in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained for publication of this study and accompanying images.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Funding

This study was supported in part by grant Faculty of Medicine, Universitas Tanjungpura, Pontianak, Indonesia.

Availability of Data

All data generated or analyzed during this study are included in this published article. For other data, these may be requested through the corresponding author.

Authors’ Contributions

Conceptualization: MMar, DFL, MMah; Data curation: MMah, HI; Formal analysis: HI; Funding acquisition: MMar, DFL, MMah; Investigation: MMar, DFL, MMah; Methodology: MMar, MMah; Project administration: MMar; Resources: MMar, DFL, MMah, HI; Software: MMah; Supervision: DFL; Validation: HI; Visualization: HI; Writing–original draft: MMar; Writing–review & editing: all authors. All authors read and approved the final manuscript.

Figure 1.
Positive finding extended-spectrum beta-lactamase production in Klebsiella pneumoniae screening by the disk diffusion test. Left to right: CAZ–AMC–CTX.
CAZ, ceftazidime; AMC, amoxicillin-clavulanate; CTX, cefotaxime. Black arrow: increase diameter in the zone inhibition towards the disk of amoxicillin-clavulanate.
Figure 1. Positive finding extended-spectrum beta-lactamase production in Klebsiella pneumoniae screening by the disk diffusion test. Left to right: CAZ–AMC–CTX.
	 
The first report of antibiotic resistance and virulence factor profiles in multidrug-resistant clinical isolates of Klebsiella pneumoniae from Pontianak, Indonesia
Table 1.
The target genes of the housekeeping gene, carbapenemase, and primer sequences of the target genes
Table 1.
Target gene Allelic variation/primer sequence (5’ to 3’) Reference
Housekeeping gene
 khe F TGATTGCATTCGCCACTGG [16]
 Hemolysin gene R GGTCAACCCAACGATCCTGG
Carbapenemase genes [17]
 ges Alleles 1–26
 Class A GES carbapenemase
 sme Alleles 1–5
 Class A SME carbapenemase
 kpc Alleles 1–23
 Class A KPC carbapenemase
 nmc/imi Alleles 1–29
 Class A NMC/IMI carbapenemase
 sim Sim
 Class B SIM carbapenemase
 gim Alleles 1–2
 Class B GIM carbapenemase
 Spm Spm
 Class B SPM carbapenemase
 ndm Alleles 1–16
 Class B NDM carbapenemase
 Vim Alleles 1–46
 Class B VIM carbapenemase
 imp Alleles 1–3, 5–6, 8–11, 15, 19–21, 24–25, 28–30, 40–42, and 47
 Class B IMP carbapenemase
 OXA-23 Alleles 23, 27, 49, 73, 133, 146, 165–171, and 225
 Class D OXA23_like carbapenemase
 OXA-24 Alleles 24–26, 40, 72, 139, and 160
 Class D OXA24_like carbapenemase
 OXA-48 Alleles 48, 162, 163, and 181
 Class D OXA48_like carbapenemase
 OXA-51 Alleles 51, 60, 65–70, 75–80, 82–84, 88–99, 106–117, 128, 130–132, 138, 144, 148–150, 172–180, 194–197, 200–206, 208, and 223
 Class D OXA51_like carbapenemase
 OXA-58 Alleles 58, 96, 97, and 164
 Class D OXA58_like carbapenemase
Virulence genes
 rmpA F ACTGGGCTACCTCTGCTTCA [18]
 Regulator of mucoid phenotype gene R CTTGCATGAGCCATCTTTCA
 acrAB F ATCAGCGGCCGGATTGGTAAA [19]
 multidrug efflux pump gene R CGGGTTCGGGAAAATAGCGCG
 tolC F ATCAGCAACCCCGATCTGCGT [19]
 multidrug efflux pump gene R CCGGTGACTTGACGCAGTCCT
Table 2.
Resistance pattern of Klebsiella pneumoniae clinical isolates according to the disk diffusion method (n=24)
Table 2.
Resistance frequency (n, %)
Antibiotics
 Penicillin
  Ampicillin 24 (100.0)
 Cephalosporin (first generation)
  Cefazolin 22 (91.7)
 Cephalosporin (third generation)
  Ceftriaxone 21 (87.5)
  Cefotaxime 21 (87.5)
  Ceftazidime 18 (75.0)
 Cephalosporin (fourth generation)
  Cefepime 21 (87.5)
 Carbapenem
  Meropenem 10 (41.7)
 Monobactam
  Aztreonam 19 (79.2)
 Beta-lactam and anti-beta-lactamase
  Amoxicillin-clavulanate 13 (54.2)
 Tetracycline (30S)
  Tetracycline 12 (50.0)
 Fluoroquinolone
  Ciprofloxacin 20 (83.3)
  Levofloxacin 17 (70.8)
 Sulfonamide and dihydrofolate reductase inhibitors
  Sulfamethoxazole-trimethoprim 20 (83.3)
 Nitrofurantoin
  Nitrofurantoin 15 (62.5)
 Phenicol (50S)
  Chloramphenicol 16 (66.7)
 Aminoglycoside (30S)
  Gentamicin 9 (37.5)
  Tobramycin 8 (33.3)
  Amikacin 2 (8.3)
 Macrolide (50S)
  Azithromycin 15 (62.5)
Drug resistance classification
  Multidrug-resistant 23 (95.8)
  Extensively drug-resistant 0 (0)
  Pan-drug-resistant 1 (4.2)

30S, ribosomal protein 30S; 50S, ribosomal protein 50S.

Table 3.
Detection of antibiotic-resistant and virulence genes in Klebsiella pneumoniae (n=24)
Table 3.
ESBL
Carbapenemase
Virulencegene
ESBL gene
ESBL-producing test
Class A
Class B
Class D
CTX-M alone SHV alone CTX-M and SHV Not detected ESBL Non-ESBL KPC SME NMC/IMI GES VIM GIM SPM NDM SIM IMP OXA-23 OXA -24 OXA -48 OXA -51 OXA- 58 rmpA acrAB tolC
6 (25.0) 1 (4.2) 14 (58.3) 3 (12.5) 5 (20.8) 19 (79.2) 0 (0) 0 (0) 0 (0) 4 (16.7) 0 (0) 0 (0) 0 (0) 5 (20.8) 2 (8.3) 0 (0) 4 (16.7) 0 (0) 10 (41.7) 5 (20.8) 0 (0) 0 (0) 23 (95.8) 21 (87.5)

Data are presented as n (%).

ESBL, extended-spectrum beta-lactamase.

  • 1. Ballen V, Gabasa Y, Ratia C, et al. Antibiotic resistance and virulence profiles of Klebsiella pneumoniae strains isolated from different clinical sources. Front Cell Infect Microbiol 2021;11:738223.
  • 2. Chang D, Sharma L, Dela Cruz CS, et al. Clinical epidemiology, risk factors, and control strategies of Klebsiella pneumoniae infection. Front Microbiol 2021;12:750662.
  • 3. Kaza P, Xavier BB, Mahindroo J, et al. Extensively drug-resistant Klebsiella pneumoniae associated with complicated urinary tract infection in Northern India. Jpn J Infect Dis 2024;77:7−15.
  • 4. Le HH, Nguyen AV, Vu LH, et al. Antimicrobial resistance patterns of common gram-negative microorganisms isolated from patients with lower respiratory tract infections in a teaching hospital in Vietnam. Jpn J Infect Dis 2024;77:144−54.
  • 5. Yang X, Man MY, Heng H, et al. Molecular epidemiology and clinical impact of Klebsiella spp. causing bloodstream infections in Hong Kong. EBioMedicine 2024;101:104998.
  • 6. Kuntaman KA, Karuniawati A, Gunardi WD, et al. Surveilans resistensi antibiotik rumah sakit di Indonesia tahun 2021 [Hospital antibiotic resistance surveillance in Indonesia in 2021] [Internet]. Surveillance of Indonesian Network for Antimicrobial Resistance, Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia; 2022 [cited 2023 Nov 11]. Available from: https://sinar.pamki.or.id/wp-content/uploads/2023/11/surveilans-resistensi-antibitik-2.pdf. Indonesian.
  • 7. Russo TA, Marr CM. Hypervirulent Klebsiella pneumoniae. Clin Microbiol Rev 2019;32:e00001−19.
  • 8. Arato V, Raso MM, Gasperini G, et al. Prophylaxis and treatment against Klebsiella pneumoniae: current insights on this emerging anti-microbial resistant global threat. Int J Mol Sci 2021;22:4042.
  • 9. Thy M, Timsit JF, de Montmollin E. Aminoglycosides for the treatment of severe infection due to resistant gram-negative pathogens. Antibiotics (Basel) 2023;12:860.
  • 10. World Health Organization (WHO) (CH). Antimicrobial resistance, hypervirulent Klebsiella pneumoniae: global situation. WHO; 2024.
  • 11. European Centre for Disease Prevention and Control (ECDC) (SE). Risk assessment: emergence of hypervirulent Klebsiella pneumoniae ST23 carrying carbapenemase genes in EU/EEA countries, first update. ECDC; 2024.
  • 12. Wyres KL, Nguyen TN, Lam MM, et al. Genomic surveillance for hypervirulence and multi-drug resistance in invasive Klebsiella pneumoniae from South and Southeast Asia. Genome Med 2020;12:11.
  • 13. Kareem SM, Al-Kadmy IM, Kazaal SS, et al. Detection of gyrA and parC mutations and prevalence of plasmid-mediated quinolone resistance genes in Klebsiella pneumoniae. Infect Drug Resist 2021;14:555−63.
  • 14. Clinical and Laboratory Standards Institute (CLSI) (US). M100 Performance standards for antimicrobial susceptibility testing. CLSI; 2023.
  • 15. Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268−81.
  • 16. Kian S, Abu TA, Hera N. Extended spectrum beta lactamase (ESBL)-producing Klebsiella pneumoniae clinical isolates and its susceptibility pattern to antibiotics at Dr. Soeradji Tirtonegoro General Hospital Klaten, Central Java. J Med Sci 2020;52:17−27.
  • 17. Al-Aajem BM, Jasim HM, Saleem AJ. Detection of Virulent genes Khe, iuc, rmp, magA in Klebsiella pneumoniae isolated from urinary tract infection. Int J Drug Deliv Technol 2021;11:1470−3.
  • 18. Vitro Master Diagnostica (TR). Antimicrobial resistance direct flow chip. Vitro Master Diagnostica; 2020.
  • 19. Bakhtiari R, Javadi A, Aminzadeh M, et al. Association between presence of RmpA, MrkA and MrkD genes and antibiotic resistance in clinical Klebsiella pneumoniae isolates from hospitals in Tehran, Iran. Iran J Public Health 2021;50:1009−16.
  • 20. Mirzaie A, Ranjbar R. Antibiotic resistance, virulence-associated genes analysis and molecular typing of Klebsiella pneumoniae strains recovered from clinical samples. AMB Express 2021;11:122.
  • 21. Seshatri S, Charan J, Tak V, et al. Frequency of OXA-Type carbapenemases among carbapenem-resistant Acinetobacter baumannii in clinical isolates from adult intensive care unit in India. J Lab Physicians 2023;16:105−11.
  • 22. Farhadi M, Ahanjan M, Goli HR, et al. High frequency of multidrug-resistant (MDR) Klebsiella pneumoniae harboring several β-lactamase and integron genes collected from several hospitals in the north of Iran. Ann Clin Microbiol Antimicrob 2021;20:70.
  • 23. Ibrahim ME. Risk factors in acquiring multidrug-resistant Klebsiella pneumoniae infections in a hospital setting in Saudi Arabia. Sci Rep 2023;13:11626.
  • 24. Tao G, Tan H, Ma J, et al. Resistance phenotype and molecular epidemiology of carbapenem-resistant Klebsiella pneumoniae isolated from Nanjing Children’s Hospital in Jiangsu Province, China. Infect Drug Resist 2022;15:5435−47.
  • 25. Mohd Asri NA, Ahmad S, Mohamud R, et al. Global prevalence of nosocomial multidrug-resistant Klebsiella pneumoniae: a systematic review and meta-analysis. Antibiotics (Basel) 2021;10:1508.
  • 26. Poerio N, Olimpieri T, Henrici De Angelis L, et al. Fighting MDR-Klebsiella pneumoniae infections by a combined host- and pathogen-directed therapeutic approach. Front Immunol 2022;13:835417.
  • 27. Virawan H, Nuryastuti T, Nirwati H. Multidrug-resistant Klebsiella pneumoniae from clinical isolates at dr. Soeradji Tirtonegoro central hospital Klaten. Indones J Med Health 2020;11:109−20.
  • 28. Wang M, Wei H, Zhao Y, et al. Analysis of multidrug-resistant bacteria in 3223 patients with hospital-acquired infections (HAI) from a tertiary general hospital in China. Bosn J Basic Med Sci 2019;19:86−93.
  • 29. Wilkowski P, Hryniewiecka E, Jasinska K, et al. Breaking antimicrobial resistance: high-dose amoxicillin with clavulanic acid for urinary tract infections due to Extended-Spectrum Beta-Lactamase (ESBL)-producing Klebsiella pneumoniae. Ann Transplant 2023;28:e939258.
  • 30. Li J, Bi W, Dong G, et al. The new perspective of old antibiotic: in vitro antibacterial activity of TMP-SMZ against Klebsiella pneumoniae. J Microbiol Immunol Infect 2020;53:757−65.
  • 31. Ozma MA, Abbasi A, Asgharzadeh M, et al. Antibiotic therapy for pan-drug-resistant infections. Infez Med 2022;30:525−31.
  • 32. Bhaskar BH, Mulki SS, Joshi S, et al. Molecular characterization of extended spectrum β-lactamase and carbapenemase producing Klebsiella pneumoniae from a tertiary care hospital. Indian J Crit Care Med 2019;23:61−6.
  • 33. Sheikh AF, Khoshnood S, Saki M, et al. Prevalence of carbapenemases and ESBL encoding genes among K. pneumoniae isolates obtained from an educational hospital in Ahvaz, Southwestern Iran. Gene Rep 2021;23:101128.
  • 34. Al-Tamimi M, Albalawi H, Shalabi M, et al. Cefixime and cefixime-clavulanate for screening and confirmation of extended-spectrum beta-lactamases in Escherichia coli. Ann Clin Microbiol Antimicrob 2022;21:20.
  • 35. Remya P, Shanthi M, Sekar U. Prevalence and clonal relatedness of NDM and OXA-48-producing Klebsiella pneumoniae in a tertiary care hospital in South India. J Lab Physicians 2019;11:312−6.
  • 36. Sandfort M, Hans JB, Fischer MA, et al. Increase in NDM-1 and NDM-1/OXA-48-producing Klebsiella pneumoniae in Germany associated with the war in Ukraine, 2022. Euro Surveill 2022;27:2200926.
  • 37. Ramirez MS, Bonomo RA, Tolmasky ME. Carbapenemases: transforming Acinetobacter baumannii into a yet more dangerous menace. Biomolecules 2020;10:720.
  • 38. Kyriakidis I, Vasileiou E, Pana ZD, et al. Acinetobacter baumannii antibiotic resistance mechanisms. Pathogens 2021;10:373.
  • 39. Pourbaghi E, Hosseini Doust R, et al. Investigation of OXA-23, OXA-24, OXA-40, OXA-51, and OXA-58 genes in carbapenem-resistant Escherichia coli and Klebsiella pneumoniae isolates from patients with urinary tract infections. Jundishapur J Microbiol 2022;15:e119480.
  • 40. Liu H, Liu X, He J, et al. Emergence and evolution of OXA-23-producing ST46Pas-ST462Oxf-KL28-OCL1 carbapenem-resistant Acinetobacter baumannii mediated by a novel IS Aba1-based Tn 7534 transposon. Antibiotics (Basel) 2023;12:396.
  • 41. Ozkul C, Hazırolan G. Oxacillinase gene distribution, antibiotic resistance, and their correlation with biofilm formation in Acinetobacter baumannii bloodstream isolates. Microb Drug Resist 2021;27:637−46.
  • 42. Zong G, Zhong C, Fu J, et al. The carbapenem resistance gene blaOXA-23 is disseminated by a conjugative plasmid containing the novel transposon Tn6681 in Acinetobacter johnsonii M19. Antimicrob Resist Infect Control 2020;9:182.
  • 43. Jang S. AcrAB-TolC, a major efflux pump in Gram negative bacteria: toward understanding its operation mechanism. BMB Rep 2023;56:326−34.
  • 44. Fanelli G, Pasqua M, Prosseda G, et al. AcrAB efflux pump impacts on the survival of adherent-invasive Escherichia coli strain LF82 inside macrophages. Sci Rep 2023;13:2692.
  • 45. Wand ME, Darby EM, Blair JM, et al. Contribution of the efflux pump AcrAB-TolC to the tolerance of chlorhexidine and other biocides in Klebsiella spp. J Med Microbiol 2022;71:001496.
  • 46. Neumann B, Sturhof C, Rath A, et al. Detection and characterization of putative hypervirulent Klebsiella pneumoniae isolates in microbiological diagnostics. Sci Rep 2023;13:19025.
  • 47. Huy TX. Overcoming Klebsiella pneumoniae antibiotic resistance: new insights into mechanisms and drug discovery. Beni Suef Univ J Basic Appl Sci 2024;13:13.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

The first report of antibiotic resistance and virulence factor profiles in multidrug-resistant clinical isolates of Klebsiella pneumoniae from Pontianak, Indonesia
Osong Public Health Res Perspect. 2025;16(2):160-168.   Published online April 4, 2025
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
The first report of antibiotic resistance and virulence factor profiles in multidrug-resistant clinical isolates of Klebsiella pneumoniae from Pontianak, Indonesia
Osong Public Health Res Perspect. 2025;16(2):160-168.   Published online April 4, 2025
Close

Figure