Division of Zoonoses, Korea National Institute of Health, Osong, Korea
© 2013 Published by Elsevier B.V. on behalf of Korea Centers for Disease Control and Prevention.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Primer name | Primer sequence (5'-3') |
---|---|
β2-microglobulin-F | GGCTCGCTCGGTGACCCTAGTCTTT |
β2-microglobulin-R | TCTGCAGGCGTATGTATCAGTCTCA |
TNF-α-F | AGCCCACGTCGTAGCAAACCACCAA |
TNF-α-R | ACACCCATTCCCTTCACAGAGCAAT |
Normalized fold | Accession number | Gene symbol | Description |
---|---|---|---|
6 h | |||
11.23 | NM_021274 | Cxcl10 | Chemokine ligand 10 |
6.61 | NM_013693 | Tnf | Tumor necrosis factor |
5.52 | NM_008352 | IL2b | Interleukin 12b |
5.27 | NM_009425 | Tnfefl0 | Tumor necrosis factor superfamily, member 10 |
4.47 | NM_010510 | Ifnb1 | Interferon beta 1 |
3.69 | NM_011577 | Tgfb1 | Transforming growth factor, beta 1 |
12 h | |||
7.9 | NM_021274 | Cxcl10 | Chemokine ligand 10 |
7.78 | NM_009399 | Tnfrsf11a | Tumor necrosis factor receptor superfamily, member 11a |
6.81 | NM_013653 | Ccl5 | Chemokine ligand 5 |
4.21 | NM_010554 | Il1a | Interleukin 1 α |
3.8 | NM_011577 | Tgfb1 | Transforming growth factor, beta 1 |
3.18 | NM_009425 | Tgfsf10 | Tumor necrosis factor superfamily, member 10 |
3.08 | NM_028679 | Irak3 | Interleukin-1 receptor-associated kinase 3 |
3.07 | AK156231 | Ccnt2 | Cyclin T2 |
24 h | |||
5.44 | NM_197889 | Ifnz | Interferon zeta |
5.16 | NM_009425 | Tnfsf10 | Tumor necrosis factor superfamily, member 10 |
4.57 | NM_013653 | Ccl5 | Chemokine ligand 5 |
4.25 | NM_008003 | Fgf15 | Fibroblast growth factor 15 |
3.68 | NM_016673 | Cntfr | Ciliary neurotrophic factor receptor |
3.54 | NM_021274 | Cxcl10 | Chemokine ligand 10 |
3.36 | NM_011888 | Ccl19 | Chemokine ligand 19 |
3.35 | NM_011577 | Tgfb1 | Transforming growth factor, beta 1 |
3.31 | NM_021887 | Il21r | Interleukin 21 receptor |
3.26 | NM_009399 | Tnfrsf11a | Tumor necrosis factor receptor superfamily, member 11a |
TNF = tumor necrosis factor.