Skip to contents Skip to Global Navigation Menu
  • KDCA
  • Contact us
  • E-Submission

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS. pISSN: 2210-9099. eISSN: 2233-6052
Articles

Multiplex Real-Time Polymerase Chain Reaction-Based Method for the Rapid Detection of gyrA and parC Mutations in Quinolone-Resistant Escherichia coli and Shigella spp.

Osong Public Health and Research Perspectives 2012;3(2):113-117.
Published online: May 31, 2012

aDivision of Enteric Bacterial Infections, Korea National Institute of Health, Osong, Korea.

bKogene Biotech, Seoul, Korea.

Corresponding author. E-mail: kkingsh@chol.com
• Received: December 19, 2011   • Revised: January 10, 2012   • Accepted: January 16, 2012

Copyright ©2012, Korea Centers for Disease Control and Prevention

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License () which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 5,544 Views
  • 30 Download
  • 6 Crossref
  • 11 Scopus
prev next
  • Two real-time polymerase chain reaction assays were developed to detect mutations in codons 83 and 87 in gyrA and in codons 80 and 91 in parC, the main sites that causes quinolone resistance in pathogenic Escherichia coli and Shigella spp. isolates. These assays can be employed as a useful method for controlling infections caused by quinolone-resistant E coli and Shigella isolates.
Fluoroquinolone is highly effective against enteric Gram-negative bacteria [1]. Within a short period of time, however, the widespread use of this drug has resulted in the emergence of fluoroquinolone-resistant, Gram-negative bacteria [2-4].
Resistance to fluoroquinolones is mainly caused by mutations in the quinolone-resistance determining regions (QRDRs) of gyrA and parC, which encode the GyrA and ParC proteins, respectively [5]. Most quinolone-resistant isolates have at least one gyrA mutation, and many have additional gyrA and/or parC mutations [2,3]. Mutations in the gyrA amino acid codons for Ser83 and/or Asp87 are commonly found in fluoroquinolone-resistant, Gram-negative bacteria [6]. Targeted mutations are also frequently present in parC in quinolone-resistant Gram-negative bacteria, including mutations in the codons for Ser80, Glu84, and/or Arg91 [7,8]. Mutations in gyrA or parC have less of an effect on resistance in Gram-negative bacteria by themselves than they do when found in combination with other mutations in these genes [9].
Currently, nucleotide sequencing is a common method for the identification of mutations in the QRDRs of gyrA and parC. Despite the widespread use of sequencing, it is slow and expensive [10]. Various alternative methods to replace sequencing have been proposed, including polymerase chain reaction (PCR)- restriction fragment length polymorphism (RFLP) [11], real-time (RT)-based detection [12], and single-stranded conformation polymorphism (SSCP) [13].
Our objective was to develop a quicker method for the detection of quinolone resistance-related mutations at the gyrA codons of Ser83 and Asp87 and the parC codons of Ser80 and Arg91 in quinolone-resistant Escherichia coli and Shigella spp. isolates. This technique is based on the detection of fluorescent emissions from the PCR products of wild-type gyrA and parC; isolates with mutations at specific sites in gyrA and parC do not emit detectable fluorescence.
The isolates used in this study are listed in Table 1. Quinolone-resistant pathogenic E coli and Shigella spp. isolates were obtained from the National Public Health Network of Korea. Each isolate was identified according to the Giraud method with some modifications [14].
Two multiplex PCR assays were developed to detect mutations in the QRDRs of gyrA and parC. In the first assay (named Gyr), Taqman MGB probes were designed to detect wild-type nucleotide sequences corresponding to the codons of Ser83 and Asp87 in gyrA; in the second assay (named Par), probes were designed to detect wildtype nucleotide sequences corresponding to the codons of Ser80 and Agr87 in parC. Selective probes for both assays were designed using Primer Express (version 3.0; Applied Biosystems, Foster City, CA, USA) to detect mutations in the second base of the each targeted codon.
Template DNA was prepared from each isolate by boiling in 100 μL of 10 mM Tris-HCl (pH 8.0) for 10 minutes. The primers were synthesized by Bioneer (Seoul, Korea), and the probes were synthesized by Applied Biosystems. For each assay set, the probe for one allele was labeled with FAM (6-carboxy-fluorescein) and the other was labeled with VIC (4,7,2'-trichloro- 7'-phenyl-6-carboxyfluorescein). The primers and probes used in this study are shown in Table 2.
All of the PCR assays were used in a final volume of 20 μL that contained 5 μL of template DNA with 0.2 μM of each primer, 0.5 μM of each probe, and 10 μL of RT-PCR master mix (Kogen Biotech, Seoul, Korea). All of the assays used the same thermocycling parameters. The reactions were performed in a LightCycler 480 system (Roche Diagnostics, Basel, Switzerland) under the following conditions: one cycle of 50℃ for 5 minutes followed by 40 cycles of 95℃ for 15 seconds and 60℃ for 1 minute.
After optimizing each assay, 14 Shigella spp. strains with known mutations in gyrA and/or parC were tested using the Gyr and Par assays. All of the known mutations at Ser83 and Asp87 were successfully detected in the gyrA mutants using the Gyr assay: 10 strains had mutations at Ser83 and one strain had a mutation at both Ser83 and Asp87. Additionally, all of the known mutations in Ser80 and Arg87 were successfully detected in the parC mutants using the Par assays. We assessed PCR amplification in all of the mutant isolates (i.e., those that did not emit fluorescence). Amplification of both the 78-base pair (bp) Gyr assay PCR product and the 98-bp Par assay PCR product were confirmed in all of the tested isolates using electrophoresis (data not shown).
To determine the accuracies of the RT-PCR assays, 48 strains of quinolone-resistant pathogenic E coli and 14 S flexneri isolates were tested using both the Gyr and Par assays. The fluorescent signals generated from the RT-PCR Gyr and Par assays were analyzed to determine the presence of mutations in gyrA and/or parC. The PCR results were confirmed by sequencing. All of the PCR results corresponded 100% with the sequencing results (Table 1). Notably, in strain QR24, a fluorescent signal was detected with the Par assay, but sequencing revealed a mutation in parC codon Ala81; however, this mutation at codon Ala81 did not affect the PCR results.
Resistance to quinolone is caused by a variety of mechanisms, such as a mutation in the targeted enzyme’s coding sequence, participation of the efflux system, and the actions of qnr [15]. Compared with other quinolone-resistance mechanisms, the largest contributing factor to resistance is alteration of the target sequence. Thus, the fast, precise detection of mutations in the QRDRs of the target enzymes is very important for controlling infections caused by quinolone-resistant strains [9].
The RT-PCR assay developed for this study can simultaneously identify mutations in specific regions of the gyrA and parC genes. Compared with similar PCR
Table 1.
MIC and nucleotide changes in the QRDRs of the gyrA and parC genes of quinolone-resistant strains of Escherichia coli and Shigella spp
Table 1.
Strain no. Species MIC RT-PCR assaya gyrA amino acid at codon parC amino acid at codon

CIPb Gyr Par 83 87 80 91

83 87 80 91 TCG (Ser) GAC (Asp) TCG (Ser) CGA (Arg)

982962 S sonnei 1.0 - + + + -T-(Leu)
994263 S sonnei 0.125 - + + + -T-(Leu)
990379 S flexneri 0.25 - + + + -T-(Leu)
990036 S flexneri 0.5 + + + - -AG(Gln)
000207 S sonnei 0.25 - + + + -T-(Leu)
000784 S flexneri 0.125 - + + + -T-(Leu)
013008 S sonnei 0.25 - + + + -T-(Leu)
020065 S sonnei 0.25 - + + + -T-(Leu)
021586 S sonnei 0.5 + + + - -AG(Gln)
020369 S flexneri 0.5 - + + + -T-(Leu)
021787 S flexneri 16 - + - - -T-(Leu) G–(Ile) -AG(Gln)
021895 S flexneri 8 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
022149 S flexneri 0.5 + + + - -AG(Gln)
QR01 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR02 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR03 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR04 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR05 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR06 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR07 E coli 64 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR08 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR09 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR10 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR11 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR12 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR13 E coli 6 - + - + -T-(Leu) G–(Ile)
QR14 E coli 6 - + - + -T-(Leu) G–(Ile)
QR15 E coli 32 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR16 E coli 6 - + - + -T-(Leu) G–(Ile)
QR17 E coli 32 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR18 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR19 E coli 32 - + - + -T-(Leu) G–(Ile)
QR20 E coli 32 - + - + -T-(Leu) G–(Ile)
QR21 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR22 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR23 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR24 E coli 32 - + + + -T-(Leu)
QR25 E coli 128 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR26 E coli 32 - + - + -T-(Leu) G–(Ile)
QR27 E coli 8 - + - + -T-(Leu) G–(Ile)
QR28 E coli 6 - + - + -T-(Leu) G–(Ile)
QR29 E coli 256 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR30 E coli 8 - + - + -T-(Leu) G–(Ile)
QR31 E coli 256 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR32 E coli 128 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR33 E coli 256< - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR34 E coli 32 - + - + -T-(Leu) G– (Ile)
QR35 E coli 32 - + - + -T-(Leu) G–(Ile)
QR36 E coli 32 - + - + -T-(Leu) G–(Ile)
QR37 E coli 32 - + - + -T-(Leu) G–(Ile)
QR38 E coli 128 - - - + -T-(Leu) -G-(Gly) G–(Ile)
QR39 E coli 128 - - - + -T-(Leu) -G-(Gly) G–(Ile)
Strain no. Species MIC RT-PCR assaya gyrA amino acid at codon parC amino acid at codon

CIPb Gyr Par 83 87 80 91

83 87 80 91 TCG (Ser) GAC (Asp) TCG (Ser) CGA (Arg)

QR40 E coli 32 - + - + -T-(Leu) G–(Ile)
QR41 E coli 64 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
QR42 E coli 32 - + - + -T-(Leu) G–(Ile)
QR43 E coli 32 - + - + -T-(Leu) G–(Ile)
QR44 E coli 32 - + - + -T-(Leu) G–(Ile)
QR45 E coli 6 - + - + -T-(Leu) G–(Ile)
QR46 E coli 4 - + - + -T-(Leu) G–(Ile)
QR47 E coli 3 - + - + -T-(Leu) G–(Ile)
QR48 E coli 32 - + - + -T-(Leu) G–(Ile)
100020 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100053 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100054 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100377 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100378 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100379 S flexneri 4 - - - - -T-(Leu) A–(Gly) G–(Ile) -AG(Gln)
100449 S flexneri 16 - - - - -T-(Leu) A–(Gly) G–(Ile) -AG(Gln)
100781 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100782 S flexneri 16 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
100985 S flexneri 16 - - - - -T-(Leu) A–(Gly) G–(Ile) -AG(Gln)
101464 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
102724 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
102725 S flexneri 4 - - - - -T-(Leu) -G-(Gly) G–(Ile) -AG(Gln)
102726 S flexneri 4 - - - - -T-(Leu) A–(Gly) G–(Ile) -AG(Gln)

a+, emitted fluorescenc; bCIP, Ciprofloxacin; -, did not emit fluorescence.

detection methods developed for use in other studies that can only identify one or two mutated sites in gyrA and parC, this RT-PCR assay is relatively simple and fast.
In the accuracy test for quinolone-resistant S flexneri isolates, this assay detected different types of mutations at gyrA codon 87. In 10 strains, the codon was mutated from aspartic acid (GAC) to glycine (GGC); in the other four strains, the codon was mutated to asparagine (AAC). This assay was designed to detect mutations in the second base pair of each targeted codon, but it also
Table 2.
Primer and probe sequences for the SNPs tests
Table 2.
Target gene Primer Sequence (5’→3’)

gyrA Detection primer F TGGTGACGTAATCGGTAAATACCA
Detection primer R GAATGGCTGCGCCATACG
SNP 83 detection probe (FAM) FAM-TGACTCGGCGGTTT- MGBNF
SNP 87 detection probe (VIC) VIC-ACGATAGTGTCATAAAC-MGBNF
parC Detection primer F GACGTACTGGGTAAATACCATCCG
Detection primer R TCAACCAGCGGATAACGGTAA
SNP 80 detection probe (FAM) FAM-GCGATAGCACCTGT-MGBNFQ
SNP 91 detection probe (VIC) VIC-AGAACGGTCGCGCC-MGBNFQ
detected mutations in the first base pair of the targeted codon. Therefore, the Par assay can also be influenced by silent mutations in the target site.
This assay cannot identify mutations outside of the four target sites (codons 83 and 87 in gyrA and codons 81 and 90 in parC ). Also, it cannot identify mutations in gyrB or parE. However, most mutations that influence quinolone resistance usually include one or more of these four target sites. Identification of mutations at these four target sites is sufficient to explain the resistance mechanism of quinolone-resistant isolates.
In conclusion, we developed a simple and efficient RT-PCR assay that simultaneously detects the major gyrA and parC mutations related to quinolone resistance. This assay can be easily applied to laboratory-based surveillance systems as a substitute method forDNAsequencing.
Acknowledgements
This study was supported by a grant from the Korea Centers for Disease Control and Prevention. The authors declare that they have no conflicting interests related to this work.
  • 1. Hooper DC. . New uses for new and old quinolones and the challenge of resistance. Clin Infect Dis 2000;30:243−54.
  • 2. Nakamura S. . Mechanism of quinolone resistance. J Infect Chemother 1997;3:128−38.
  • 3. Lautenbach E Strom BL Nachamkin I et al. Longitudinal Trends in fluoroquinolone resistance among Enterobacteriaceae isolates from inpatients and outpatients, 1989–2000: differences in the emergence and epidemiology of resistance across organisms. Clin Infect Dis 2004;38:655−62.
  • 4. Uchida Y Mochimaru T Morokuma Y et al. Geographic distribution of fluoroquinolone-resistant Escherichia coli strains in Asia. Int J Antimicrob Agents 2010;35:358−73.
  • 5. Drlica K Zhao X . DNA gyrase, topoisomerase IV, and the 4-quionoloe. Microbiol Mol Biol Rev 1997;61:377−92.
  • 6. Ruiz J Gomez J Navia MM et al. High prevalence of nalidixic acid resistant ciprofloxacin susceptible phenotype among clinical isolates of Escherichia coli and other Enterobacteriaceae. Diag Microbiol Infect Diseases 2002;42:257−61.
  • 7. Jung D Lee M Kim J et al. Isolation of quinolone-resistant Escherichia coli found in major rivers in Korea. J Microbiol. 2006;44:680−4.
  • 8. Kim J Kim S Jeon S et al. Resistance to fluoroquinolones by the combination of target site mutations and enhanced expression of genes for efflux pumps in Shigella flexneri and Shigella sonnei strains isolated in Korea. Clin Microbiol Infect 2008;14:760−5.
  • 9. Heaton VJ Ambler JE Fisher LM. . Potent antipneumococcal activity of gemifloxacin is associated with dual targeting of gyrase and topoisomerase IV, an in vivo target preference for gyrase, and enhanced stabilization of cleavable complexes in vitro. Antimicrob Agents Chemother 2000;44:3112−7.
  • 10. Rodrigo A Estibaliz M Romon C . Detection of parC mutation in Streptococcus pneumonia by real-time PCR and Taqman-MGB probes. J Microbiol Method 2007;69:214−7.
  • 11. Lysnyansky I Mikula I Gerchman I Levisohn S . Rapid detection of a point mutation in the parC gene associated with decreased susceptibility to fluoroquinolones in Mycoplasma bovis. Antimicrob Agents Chemother 2009;53:4911−4.
  • 12. Page S Vernel PF O’Conneor O et al.. Real-time PCR detection of gyrA and parC mutation in Streptococcus pneumonia. Antimicrob Agents Chemother 2008;52:4155−8.
  • 13. Deborah JE Ernesto L Martin JW Laura JP. . Detection gyrA mutations in quinolone-resistant Salmonella enteric by denaturin high-peformance liquid chromatography. J Clin Microbiol. 2002;40:4121−5.
  • 14. Giraud E Brisabois A Martel JL Chaslus DE . Comparative studies of mutations in animal isolates and experimental in vitro and in vivo-selected mutants of Salmonella spp. suggest a counter selection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother 1999;43:2131−7.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Multiplex Real-Time Polymerase Chain Reaction-Based Method for the Rapid Detection of gyrA and parC Mutations in Quinolone-Resistant Escherichia coli and Shigella spp.
Osong Public Health Res Perspect. 2012;3(2):113-117.   Published online June 30, 2012
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Multiplex Real-Time Polymerase Chain Reaction-Based Method for the Rapid Detection of gyrA and parC Mutations in Quinolone-Resistant Escherichia coli and Shigella spp.
Osong Public Health Res Perspect. 2012;3(2):113-117.   Published online June 30, 2012
Close