Figure 1The multiplex PCR results. Lanes 2–4, uniplex PCR of some representative strains of Vibrio cholera, Salmonella spp., and Shigella spp., respectively. Lane 1, multiplex PCR for the same three bacterial strains in a single PCR tube. M = molecular weight (100 bp DNA ladder); PCR = polymerase chain reaction.
Table 1Bacterial strains included in this study, and performance of the multiplex PCR assay for detecting Salmonella, Shigella, and Vibrio cholera.
Strains |
Reference |
Multiplex PCR results |
Salmonella serovar Albany |
ATCC 51960 |
+ |
Salmonella serovar Enteritidis |
ATCC 4931 |
+ |
Salmonella serovar Hadar |
ATCC 51956 |
+ |
Salmonella serovar Reading |
ATCC 6967 |
+ |
Salmonella serovar Typhi |
ATCC 19430 |
+ |
Salmonella serovar Typhimurium |
ATCC 14028 |
+ |
Citrobacter freundii
|
ATCC 8090 |
− |
Escherichia coli
|
ATCC 25922 |
− |
Shigella flexneri
|
PTCC 1234 |
+ |
Shigella soneii
|
ATCC 9290 |
+ |
Staphylococcus aureus
|
PTCC 1189 |
− |
Vibrio cholerae
|
PTCC 1611 |
+ |
Table 2Primers sequences used for amplification by multiplex PCR.
Primer name |
Sequence (5′→3′) |
Product (bp) |
Target |
Reference |
Vibrio-F Vibrio-R |
ATAATGGCTCACCAAGAAGG TTAGAACTTATAACCACC |
592 |
ompW
|
This study |
Shigella-F Shigella -R |
TCCGTCATGCTGGATGAACGATGT ACAGTTCAGGATTGCCCGAGACACA |
159 |
Putative integrase
|
Ranjbar et al [2]
|
Salmonella-F Salmonella-R |
GTATTGTTGATTAATGACATCCG ATATTACGCTACGGAAACACGTT |
403 |
invA
|
This study |