Division of Bacterial Respiratory Infections, Korea National Institute of Health, Osong, Korea
© 2011 Published by Elsevier B.V. on behalf of Korea Centers for Disease Control and Prevention.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Gene | Size of gene | Primer sequence | Size of analyzed region | Reference |
---|---|---|---|---|
Housekeeping genes | ||||
Adenylate kinase (Adk) | 657 bp | F : AGCCGCCTTTCTCACCCAACACT R : TGGGCCCAGGACGAGTAGT | 530 bp (30 bp–560 bp) | Bordetella MLST sequence type database ( |
Fumarate hydratase class II (FumC) | 1392 bp | F : CGTGAACCGGGGCCAGTCGTC R : GGCCAGCCAGCGCACATCGTT | 498 bp (396 bp–894 bp) | |
Serine hydroxymethyl-transferase (GlyA) | 1248 bp | F : CAACCAGGGCGTGTACATGGC R : CCGCGATGACGTGCATCAG | 499 bp (402 bp–901 bp) | |
Aromatic amino-acid aminotransferase (TyrB) | 1203 bp | F : CGAGACCTACGCTTATTACGAT R : TGCCGGCCAGTTCATTTT | 487 bp (462 bp–949 bp) | |
Isocitrate dehydrogenase (Icd) | 1257 bp | F : CTGGTCCACAAGGGCAACAT R : ACACCTGGGTGGCGCCTTC | 512 bp (704 bp–1216 bp) | |
Cytosol aminopeptidase (PepA) | 1500 bp | F : CGCCCCAGGTTGAAGAAAATCGTC R : ATCAGGCCCACCACATCCAG | 508 bp (454 bp–962 bp) | |
Phosphoglucomutase (Pgm) | 1383 bp | F : CGCCCATGTCACCAGCACCGA R : CGCCGTCTATCGTAACCAG | 548 bp (672 bp–1216 bp) | |
Antigenic determinant genes | ||||
Pertussis toxin subunit 1 (PtxS1) | 810 bp | F : ACCATCAAAACGCAGAGGGGAAGA R : AGGAGGGCCAACGGCAGA | 935 bp (−29 bp to +98 bp) | |
Pertactin (Prn) | 2739 bp | F : GCCAATGTCACGGTCCAA R : CGGATTCAGGCGCAACTC | 1,410 bp (649 bp–2059 bp) | |
Filamentous hemagglutinin (FHA) | 10,772 bp | F : TCGCCATTTCGGCGCACG R : AGATCGAGCTGCGCGCCG | 372 bp (2348 bp–2720 bp) | This study |
Fimbriae 2 (Fim2) | 624 bp | F : GCATAGACCATCTTGTATG R : CCGGCCGGGCTCCTTGAG | 388 bp (334 bp to +98 bp) | |
Fimbriae 3 (Fim3) | 615 bp | F : CCCCCGGACCTGATATTGTGATG R : GCTGAGCGTGCTGAAGGACAAGAT | 810 bp (−68 bp to +119 bp) | |
Outer-membrane protein Q (OmpQ) | 1095 bp | F : ATGCGTCGTCTTCTCGTC R : TCAGAAGCGCTGGGTCAT | 1,095 bp (1 bp–1,095 bp) | This study |
Bordetella antitransporter-protein C (BapC) | 2268 bp | F : GACAACGGTGTCTGGGGC R : GCGCAGGTGGAACGTCCA | 935 bp (1,327 bp–2,262 bp) | This study |
Adenylate cyclase toxin (CyaA) | 5121 bp | F : ACCGCCTACGGCAAGCGC R : GCCGCCTTCAAGGGTATC | 1,043 bp (2,935 bp–3,987 bp) | This study |
Virulence-activated gene (Vag8) | 2748 bp | F : ATGGCAGGACAAGCGAGG R : CCGCGTACCCGTCAACGT | 741 bp (1 bp–741 bp) | This study |
Tracheal colonizing factor (TcfA) | 2019 bp | F : ATGCACATTTACGGAAATATGA R : TATGCGTGCCCGGGTCATAG | 1,105 bp (1 bp–1,105 bp) | This study |
Gene | Polymorphic sites | Allele | References |
---|---|---|---|
Pertussis toxin subunit 1 (PtxS1) | PtxS1A(1)PtxS1B(2)PtxS1C(3)PtxS1D(4)PtxS1E(5)PtxS1F(6)PtxS1G(7)PtxS1H(8) | ||
Pertactin (Prn) | Prn(1)Prn(2)Prn(3)Prn(4)Prn(5)Prn(6)Prn(7)Prn(8)Prn(9)Prn(10)Prn(11) | ||
Filamentous hemagglutinin (FHA) | FHA(1)FHA(2) | ||
Fimbriae2 (Fim2) | Fim2(1)Fim2(2) | ||
Fimbriae3 (Fim3) | Fim3(1)Fim3(2)Fim3(3)Fim3(4)Fim3(5) | ||
Outer membrane protein Q (OmpQ) | OmpQ(1)OmpQ(2) | ||
Bordetella autotransporter protein C (BapC) | BapC(1)BapC(2) | ||
Adenylate cyclase toxin (CyaA) | CyaA(1)CyaA(2) | ||
Virulence activated gene (Vag8) | Vag8(1)Vag8(2) | ||
Tracheal colonizing factor (TcfA) | TcfA(1)TcfA(2)TcfA(3)TcfA(4)TcfA(5)TcfA(6)TcfA(7) |
Gene | No. reported genotypes | No. confirmed genotypes | Type and frequency (%) |
---|---|---|---|
Housekeeping genes | |||
Adk | 2 | 2 | Type 1 (96.7), type 2 (3.3) |
Fum C | 1 | 1 | Type 1 (100) |
Gly A | 1 | 1 | Type 1 (100) |
Tyr B | 2 | 2 | Type 1 (9.8), type 3 (90.2) |
Icd | 1 | 1 | Type 1 (100) |
Pep A | 1 | 1 | Type 1 (100) |
Pgm | 1 | 1 | Type 1 (100) |
Antigenic determinant genes | |||
PtxS1 | 8 | 5 | Type 1 (93.2), type 2 (1.4), type 4 (1.4), type 5 (2.7%), type 8 (1.4) |
Prn | 11 | 2 | Type 1 (96.7), type 6 (3.3) |
Fha | 2 | 2 | Type 1 (96.7), type 2 (3.3) |
Fim2 | 2 | 1 | Type 1 (100) |
Fim3 | 5 | 2 | Type 1 (21.3), type 2 (78.7) |
Omp Q | 2 | 2 | Type 1 (3.3), type 2 (96.7) |
Bap C | 2 | 2 | Type 1 (96.7), type 2 (3.3) |
Cya A | 2 | 2 | Type 1 (3.3), type 2 (96.7) |
Vag 8 | 2 | 2 | Type 1 (3.3), type 2 (96.7) |
Tcf A | 9 | 2 | Type 1 (3.3), type 2 (96.7) |
Allele type | GenBank accession no. or ref. | Korea (n = 81 | Japan (n = 107)2) | Taiwan (n = 80)3) | USA (n = 152)4) | Finland (n = 122)5) | UK (n = 335)6) | Sweden (n = 1006)7) | Australia (n = 46)8) | Italy (n = 30)9) |
---|---|---|---|---|---|---|---|---|---|---|
1968–2010 | 1988–2001 | 1998–2004 | 1935–1996 | 1953–2003 | 1920–2002 | 1970–2003 | 1970–2003 | 1993–1995 | ||
S1A (1) | 71 | 23 | 79 | 98 | 115 | 288 | 998 | 46 | 30 | |
S1B (2) | 6 | 84 | 1 | 51 | 7 | 36 | 8 | – | – | |
S1C (3) | – | – | – | – | – | – | – | – | – | |
S1D (4) | 1 | – | – | 3 | – | – | – | – | – | |
S1E (5) | 2 | – | – | – | – | – | – | – | – | |
S1F (6) | – | – | – | – | – | – | – | – | – | |
S1G (7) | – | – | – | – | – | – | – | – | – | |
S1G (8) | HM212424 | 1 | – | – | – | – | – | – | – | – |
Allele type | GenBank accession no. or ref. | Korea (n = 81 | Japan (n = 107)2) | Taiwan (n = 80)3) | USA (n = 152)4) | Finland (n = 122)5) | UK (n = 335)6) | Sweden (n = 919)7) | Australia (n = 46)8) | Italy (n = 129)9) |
---|---|---|---|---|---|---|---|---|---|---|
1968–2010 | 1988–2001 | 1998–2004 | 1935–1996 | 1953–2003 | 1920–2002 | 1992–2000 | 1970–2003 | 1993–1995 | ||
Prn (1) | 72 | 88 | 6 | 86 | 26 | 213 | 51 | 38 | 8 | |
Prn (2) | 7 | 18 | 72 | 66 | 92 | 111 | 748 | 3 | 53 | |
Prn (3) | AF.48485 | – | 1 | 2 | – | 2 | 6 | 116 | 5 | 65 |
Prn (4) | – | – | – | – | 2 | – | – | – | – | |
Prn (5) | – | – | – | – | – | – | – | – | 3 | |
Prn (6) | 2 | – | – | – | – | – | – | – | – | |
Prn (7) | – | – | – | – | – | – | – | – | – | |
Prn (8) | – | – | – | – | – | – | – | – | – | |
Prn (9) | – | – | – | – | – | – | – | – | – | |
Prn (10) | – | – | – | – | – | – | – | – | – | |
Prn (11) | – | – | – | – | – | – | – | – | – |
ST of Housekeeping genes (HST) | Genotype | ||||||
---|---|---|---|---|---|---|---|
GlyA | Adk | Icd | Tyr B | Pep A | Pgm | Fum C | |
1 (4.9%) | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
2 (92.6%) | 1 | 1 | 1 | 3 | 1 | 1 | 1 |
24 (2.5%) | 1 | 2 | 1 | 1 | 1 | 1 | 1 |
ST of Antigenic determinant genes (AST) | Genotype | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
PtxS1 | Prn | FHA | Fim2 | Fim3 | OmpQ | BapC | CyaA | Vag8 | TcfA | |
1 (72.8%) | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 2 | 2 | 2 |
2 (8.6%) | 1 | 2 | 1 | 1 | 1 | 2 | 1 | 2 | 2 | 2 |
3 (6.2%) | 1 | 1 | 1 | 1 | 1 | 2 | 1 | 2 | 2 | 2 |
4 (2.5%) | 5 | 6 | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 1 |
5 (1.2%) | 4 | 1 | 1 | 1 | 2 | 2 | 1 | 2 | 2 | 2 |
6 (7.4%) | 2 | 1 | 1 | 1 | 1 | 2 | 1 | 2 | 2 | 2 |
7 (1.2%) | 8 | 1 | 1 | 1 | 2 | 2 | 1 | 2 | 2 | 2 |
Gene type | Group | ST | Frequency | SLV | DLV | SAT |
---|---|---|---|---|---|---|
Housekeeping genes | 1 | 4752 | 211 | 11 | ––– | |
Antigenic determinant genes | 61 | 65951172 | 133221– | 422222– | 000112– |
Time periods | Housekeeping genes | Antigenic determinant genes | ||||
---|---|---|---|---|---|---|
Major ST | Genotype profile | Frequency (%) | Major ST | Genotype profile | Frequency (%) | |
Tohama I | 1 | 1,1,1,1,1,1,1 | – | – | 2,1,2,1,1,2,1,2,2,2 | – |
Old (1968/1975) | 1 | 1,1,1,1,1,1,1 | 80 | 6 | 2,1,1,1,1,2,1,2,2,2 | 100 |
1999 ∼ 2008 | 2 | 1,1,1,3,1,1,1 | 96.9 | 1 | 1,1,1,1,2,2,1,2,2,2 | 87.5 |
Outbreak in 2009 | 2 | 1,1,1,3,1,1,1 | 100 | 2 | 1,2,1,1,1,2,1,2,2,2 | 58.3 |
Adk, adenylate kinase; fumC, fumarate hydratase class II, glyA, serine hydroxymethyltransferase; tyrB, aromatic amino-acid aminotransferase; icd, isocitrate dehydrogenase; pepA, cytosol aminopeptidase; pgm, phosphoglucomutase; ptxS1, pertussis toxin; prn, pertactin; fha, filamentous hemagglutinin; fim2, fimbriae2; fim3, fimbriae3; ompQ, outer-membrane protein Q; bapC,
Strain number reconstructed from data of the indicated reference. Number of tested strain was reconstructed from cited references (superior number). 1) In this study; 2) Kodama et al., 2004
Strain number reconstructed from data of the indicated reference. Number of tested strain reconstructed from cited references (superior number). 1) In this study; 2) Kodama et al., 2004
Adk, adenylate kinase; fumC, fumarate hydratase class II, glyA, serine hydroxymethyltransferase; tyrB, aromatic amino-acid aminotransferase; icd, isocitrate dehydrogenase; pepA, cytosol aminopeptidase; pgm, phosphoglucomutase; ptxS1, pertussis toxin; prn, pertactin; fha, filamentous hemagglutinin; fim2, fimbriae2; fim3, fimbriae3; ompQ, outer-membrane protein Q; bapC,
SLV, single locus variation; DLV, double locus variation; SAT, satellite strain. Group definition (N−1). Central types.
Gene order of housekeeping genes: GlyA, Adk, Icd, TyrB, PepA, Pgm, FumC. Gene order of antigenic determinant genes: PtxS1, Prn, FHA, Fim2, Fim3, OmpQ, BapC, CyaA, Vag8, TcfA.