Skip Navigation
Skip to contents

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > Osong Public Health Res Perspect > Volume 11(5); 2020 > Article
Original Article
Characterization of Antimicrobial Susceptibility, Extended-Spectrum β-Lactamase Genes and Phylogenetic Groups of Enteropathogenic Escherichia coli Isolated from Patients with Diarrhea
Erfaneh Jafari, Saeid Mostaan, Saeid Bouzari
Osong Public Health and Research Perspectives 2020;11(5):327-333.
DOI: https://doi.org/10.24171/j.phrp.2020.11.5.09
Published online: October 22, 2020

Molecular Biology Department, Pasteur Institute of Iran, Tehran, Iran

*Corresponding author: Saeid Bouzari, Molecular Biology Department, Pasteur Institute of Iran, Tehran, Iran, E-mail: saeidbouzari@yahoo.com
• Received: June 20, 2020   • Revised: July 21, 2020   • Accepted: September 6, 2020

Copyright ©2020, Korea Centers for Disease Control and Prevention

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  • 7,561 Views
  • 101 Download
  • 5 Web of Science
  • 7 Crossref
  • 5 Scopus
  • Objectives
    Infectious diarrhea is one of the most common causes of pediatric death worldwide and enteropathogenic Escherichia coli (EPEC) is one of the main causes. There are 2 subgroups of EPEC, typical and atypical, based on the presence or absence of bundle forming pili (bfp), of which atypical EPEC is considered less virulent, but not less pathogenic. Antimicrobial resistance towards atypical EPEC among children is growing and is considered a major problem. In this study the pattern of antibiotic resistance in clinical isolates was determined.
  • Methods
    Using 130 isolates, antibiotic resistance patterns and phenotypes were assessed, and genotypic profiles of extended spectrum β-lactamase (ESBL) production using disc diffusion and PCR was carried out. Phylogenetic groups were analyzed using quadruplex PCR.
  • Results
    There were 65 E. coli isolates identified as atypical EPEC by PCR, among which the highest antibiotic resistance was towards ampicillin, followed by trimethoprim-sulfamethoxazole, and tetracycline. Multidrug resistance was detected in 44.6% of atypical EPEC isolates. Around 33% of isolates were determined to be extended spectrum β-lactamase producers, and in 90% of isolates, genes responsible for ESBL production could be detected. Moreover, the majority of atypical EPEC strains belonged to Group E, followed by Groups B1, B2 and C.
  • Conclusion
    High rates of multidrug resistance and ESBL production among atypical EPEC isolates warrant periodical surveillance studies to select effective antibiotic treatment for patients. It is considered a critical step to manage antibiotic resistance by avoiding unnecessary prescriptions for antibiotics.
Escherichia coli (E. Coli) in general are a common human pathogen with 6 known pathotypes, among which enteropathogenic E. coli (EPEC) causes the majority of cases of diarrhea in developing countries, and is considered the main cause of infant mortality [1]. Based on the present or absence of bundle forming pili (bfp), 2 subgroups of EPEC (typical EPEC and atypical EPEC) have been identified [1]. Due to the absence of the E. coli adherence factor EAF plasmid which encodes bfp, atypical EPEC are considered less virulent, although they are not less pathogenic [2], and have been emerging more in recent years [3]. Atypical EPEC pathogenesis involves an attaching and an effacing (A/E) lesion, and the genes that are responsible for the production of these lesions are called intimin (eae) and translocated receptor (tir). These genes are located on a pathogenicity island named the Locus of Enterocyte Effacement. The interaction of eae and tir are responsible for the attachment of bacteria to host cells, and actin pedestal formation in intestinal cells which characterizes the A/E pathogens [1].
Extended spectrum β-lactamases (ESBLs) are specific enzymes which are bacterial chromosome mediated and plasmid mediated [4]. ESBLs may include Class A, C or D enzymes that are generally inhibited by clavulanic acid, and their most common spread mechanism is by horizontal gene transfer [5]. Class A enzymes including TEM, SHV, and CTX-M, and Class D enzyme OXA are mostly found among Enterobacteriaceae [5]. As ESBL producing organisms also display resistance to other classes of antibiotics [6], they lead to the development of multidrug resistant (MDR) strains. In recent years, due to the excess prescription of various antibiotics (such as β-lactams) against infections, high levels of antibiotic resistance are being detected which are linked to both typical and atypical EPEC strains [7,8]. Therefore, the selection of effective antibiotics for patients is considered critical [9,10], together with reduced prescriptions for antibiotics.
Phylogenetic analysis of E. coli clinical strains provides information about the frequency of occurrence in the environment, and based on the presence or absence of certain genes and DNA fragments (including chuA, yjaA, arpA genes and a DNA fragment TspE4.C2), E. coli can be classified into phylogenetic groups (A, B1, B2, C, D, E and F) [11]. Majority of commensal E. coli strains belong to phylogroups A and B1 [12], and extraintestinal pathogenic E. coli mainly belongs to phylogroups B2 and D [13]. However, as the arrangement of phylogroups for diarrheagenic E. coli is still unclear, EPEC could belong to any of the phylogroups [14,15].
In the present study, antibacterial resistance patterns, ESBL production and phylogenetic groups associated with clinical isolates were evaluated.
1. Sampling and processing
Stool samples from patients with diarrhea inoculated on MacConkey agar were collected from different reference hospitals during a 1-year period 130 samples from varying age groups (58 patients under 6 years old, 34 patients between 10–30 years, and 38 patients older than 30 years) had been biochemically confirmed as E. coli and 5 colonies from each of their MacConkey agar plate tested by PCR to identify the presence of eae (F primer, AGGCTTCGTCACAGTTG and R primer, CCATCGTCACCAGAGGA) [16] or bfp (F primer, GACACCTCATTGCTGAAGTCG and R primer, CCAGAACACCTCCGTTATGC) [17], as EPEC virulence genes and absence of stx1 (F primer, CGATGTTACGGTTTGTTACTGTGACAGC and R primer, AATGCCACGCTTCCCAGAATTG) and stx2 (F primer, GTTTTGACCATCTTCGTCTGATTATTGAG and R primer, AGCGTAAGGCTTCTGCTGTGAC) genes [17]. E. coli strain E2348/69 was used as a positive control for both eae and bfp genes, and E. coli strain O157/H7 was used as a positive control for stx1 and stx2 genes. Non-pathogenic E. coli strain DH5α was used as negative control to monitor PCR contamination. PCR conditions for the detection of virulence genes were as follows: 95°C for 3 minutes, 30 cycles of 94°C for 1 minute, 60°C for 45 seconds, 72°C for 45 seconds, and a final extension at 72°C for 5 minutes.
All sampling protocols in this study were approved by the ethics committee of the Pasteur Institute, Iran (ethical no.: IR.PII.REC.1397.003).
2. Antimicrobial susceptibility testing
Antimicrobial susceptibility tests were performed on Mueller-Hinton agar (Himedia, India) using commercial antimicrobial discs (BD BBL, USA), based on Kirby-Bauer’s method [18] according to the guidelines of the clinical and laboratory standards institute [19].
The antibiotics used were ampicillin (10 μg), amikacin (30 μg), ceftazidime (30 μg), cefotaxime (30 μg), ciprofloxacin (5 μg), ertapenem (10 μg), imipenem (10 μg), levofloxacin (5 μg), piperacillin-tazobactam (100 + 10 μg), tetracycline (30 μg) and trimethoprim-sulfamethoxazole (1.25 + 23.75 μg).
Multidrug resistance was defined by discerning non-susceptibility to at least 1 antibiotic in 3 or more antimicrobial categories [20]. E. coli ATCC 25922 was used for quality control.
3. Phenotypic characterization of ESBL producing strains
Detection of ESBLs were performed using the double disk synergy test method [19] using ceftazidime (30 μg) and cefotaxime (30 μg) discs (BD BBL, USA), and placing each from a disc containing ceftazidime + clavulanic acid (30 + 10 μg) and cefotaxime + clavulanic acid (30 + 10 μg) (BD BBL, USA), respectively. ESBL producing was determined by the expansion of ≥ 5 mm of the zone diameters of combined discs compared to ceftazidime and cefotaxime zones.
4. Genotypic characterization of ESBL producing strains
β-lactamase genes blaCTX-M9 (F primer, GTGACAAAGAGAGTGCAACGG and R primer, ATGATTCTCGCCGCTGAAGCC) [21], blaSHV (F primer, TCGCCTGTGTATTATCTCCC and R primer, CGCAGATAAATCACCACAATG) [22], blaOXA (F primer, GCGTGGTTAAGGATGAACAC and R primer, CATCAAGTTCAACCCAACCG) [23] and blaTEM (F primer, GCGGAACCCCTATTTG and R primer, ACCAATGCTTAATCAGTGAG) [24] were detected by PCR using these specific primers. DNA was extracted by boiling method and the PCR procedure was performed in a total volume of 25 μL, using 12 μL of Taq DNA Polymerase Mix Red-Mgcl2 2 mM (Ampliqon), 9 μL of DNase/RNase free distilled water (ThermoScientific), 1 μL of 10 pM for reverse and forward primers, and 2 μL of DNA template.
5. Identification of phylogroups
All the EPEC strains were assessed for phylogenetic groups A, B1, B2, C, D, E and F using quadruplex multiplex PCR [11]. Agarose gel electrophoresis of the PCR product was carried out in 2% agarose gel containing DNA Gel dye.
6. Statistical analysis
Pearson correlation test was performed using SPSS Version 18 (Spss Inc., Chicago, IL, USA) for statistical analysis of the data. Correlation is significant at the 0.01 level (2-tailed).
There were a total of 130 E. coli isolates tested for eae, bfp, stx1, and stx 2 genes using PCR; from which 65 isolates (50%) were positive for the eae gene and negative for bfp, stx1, and stx2 genes. None of the isolates were positive for the bfp gene, the characteristic of typical EPEC, therefore they were classified as atypical EPEC. Of the positive isolates, 30 (46.15%) belonged to children under 6 years, 21 (32.3%) belonged to 10–30 year olds, and the rest of the isolates were from patients older than 30 years.
The antibiotic susceptibility test (Tables 1 and 2), showed that among the 65 atypical EPEC isolates positive for the eae gene, 21.5% were sensitive to all 11 antibiotic discs, and 78.5% showed resistance to at least 1 of the antibiotic discs. From these isolates 33.8% (22 of 65) were ESBL producers.
The highest resistance to an antibiotic was towards ampicillin (70.8%), followed by trimethoprim-sulfamethoxazole (56.9%), and tetracycline (46.2%). All isolates were susceptible to imipenem and ertapenem. Most of the isolates were susceptible to piperacillin-tazobactam, and amikacin, except for 2 isolates that showed resistance to piperacillin-tazobactam. All ESBL positive isolates were also susceptible to imipenem, ertapenem, piperacillin-tazobactam and amikacin, except for 1 isolate that showed resistance to piperacillin-tazobactam. Multidrug resistance was detected in 29 (44.6%) atypical EPEC isolates, and 58.62% of MDR isolates were ESBL producing. In addition, 51.7% of children under 6 had isolates which displayed MDR.
There was a strong, positive correlation between ESBL positive and cefotaxime resistance, which was statistically significant (r = 0.914, n = 65, p < 0.001). There were also moderate, significant positive correlation between ESBL positive and ceftazidime, ciprofloxacin, or trimethoprim-sulfa resistance (r = 0. 598, 0.329, 0.367, respectively, n = 65, p < 0.01). There was a weak, significant positive correlation between ESBL positive and levofloxacin resistance (r = 0.282, n = 65, p = 0.023). Finally, there was no correlation between ESBL positive and piperacillin-tazo, ertapenem, imipenem, tetracyclines, amikacin and ampicillin resistance (Table 2).
Studying 4, β-lactamase producing genes in 22 ESBL positive isolates (using PCR) showed 20 (90.9%) isolates were positive at least for 1 of these ESBL encoding genes. The blaCTX-M9 gene was detected in 15 strains (68.2%), blaSHV gene in 10 strains (45.4%), blaOXA gene in 9 strains (40.9%) and blaTEM gene in 12 strains (54.5%). According to molecular resistance profile of ESBL-producing isolates, 2 strains contained all 4 genes, 3 and 2 genes patterns were detected in 6, and 8 strains, and 4 strains had only 1 of the evaluated genes (Table 3).
Furthermore, comparison of phenotypic and genotypic antimicrobial patterns in ESBL producing isolates showed all strains containing ESBL encoding genes were also susceptible to amikacin. CTX-M9 positive strains had a high rate of resistance to trimethoprim-sulfamethoxazole (73.3%) and tetracycline (33.3%). TEM and OXA positive strains also had a high rate of resistance to trimethoprim-sulfamethoxazole (91.7%), (100%) and tetracycline (66.7%), (44.4%), respectively; and SHV positive strains had a high rate of resistance to trimethoprim-sulfamethoxazole (70%).
In Table 4, phylogenic grouping of the EPEC isolates were assigned according to the Clermont’s quadruplex phylo-group method (Figure 1). These results revealed Group E as the predominant phylogroup (26.2% occurrence), followed by Groups B1 (20%), B2 (13.9%) and C (12.3%). Groups A and D showed a prevalence of 3.07%; moreover approximately 18.5% of the isolates remained unclassified, and no strains belonged to Group F.
In addition, the antimicrobial resistance pattern among atypical EPEC phylogroups showed that a greater number of resistance patterns were seen in group E, followed by Groups B1, C and B2. Furthermore, 50% of ESBL positive isolates belonged to Group E (Table 5).
EPEC are among the most predominant E. coli pathotypes in children under 5 [25,26], and one of the most important fatal pediatric pathogens in the developing world which is responsible for nearly 1.6–2.5 million infant deaths each year [9,25,27].
While assessing virulence genes among E. coli isolates, only atypical EPEC subtypes were identified, which is in accordance with an increased incidence of atypical EPEC in different studies [2833]. Antibacterial assessment of 11 antibiotics in 65 atypical EPEC isolates demonstrated high rates of antibacterial resistance. These results are in agreement with other findings [3,28]. Over prescription and overuse of antibiotics is the main cause of resistance emergence among isolates, which is a major public health concern.
In the current study, high levels of resistance to ampicillin, trimethoprim-sulfamethoxazole and tetracycline were observed, which is in agreement with previous findings in India, China, Iran, Brazil, Tanzania and Peru [2,3,28,3436]. Compared with the studies by Bakhshi et al [33] and Memariani et al [37], our study revealed lower rates of ciprofloxacin resistance in atypical EPEC isolates.
The incidence of multidrug resistance among the isolates in this current study was 44.6%, which was lower than other studies conducted in Iran [28,38], while sensitivity toward imipenem and ertapenem, was similar to some studies [38,39]. The majority of the isolates were also susceptible to amikacin and piperacillin-tazobactam showing their effectiveness against atypical EPEC clinical strains.
ESBL production was observed in 33.8% of strains however, 77.3% of these strains showed MDR. There was 95.5% resistance to cefotaxime which was higher than a prior report [37]. The genotypic method, in this study showed 90.9% of the ESBL positive strains carried at least 1 ESBL encoding gene, among which CTX-M9 was the most common (68.2%), followed by TEM (54.5%), SHV (45.4%), and OXA (40.9%). These results are different from the previous study performed by Singh et al [2], although the prevalence of the SHV gene was higher than those reported in other studies [3,38].
The results in this current study showed a significant statistical difference in cefotaxime, ceftazidime, ciprofloxacin, levofloxacin, ampicillin and trimethoprim-sulfamethoxazole resistance between ESBL positive and ESBL negative isolates, which is in agreement with another study [40], and supports the fact that ESBL encoding plasmids also carry resistance genes for other antimicrobial drugs.
Phylogenetic evaluations revealed that the majority of atypical EPEC isolates belonged to 1 of 4 phylogroups; E, B1, B2 and C, and represented more affiliation with Group E, which was different to the findings from other studies [2,29,38,41]. None of the isolates were associated with Group F, which is in accordance with other reported studies [2,41].
Observing the relationship between phylogenetic group and antimicrobial pattern among EPEC phylogroups, the results showed that all of the B1 groups, and the majority of B2 groups, belonged to non-ESBL producing atypical EPEC, whereas half of the ESBL positive isolates, as well as the majority of MDR isolates belonged to Group E. High rates of resistance in phylogroup E was due to ampicillin and trimethoprim-sulfamethoxazole, followed by cefotaxime and tetracycline resistance. Whereas resistance of Groups B1 and B2 was due to ampicillin, tetracycline, and trimethoprim-sulfamethoxazole resistance. Group E also presented a higher percentage of MDR than other groups.
In conclusion, this study indicated resistance emergence among isolates, which is a major public health concern. Therefore, periodical surveillance studies to select effective antibiotics for patients, is considered a critical step to manage E. coli resistance, in addition to overprescribing antibiotics to patients.
Acknowledgements
This project was financially supported by the Pasteur institute of Iran (Grant no.: 1045).

Conflicts of Interest

The authors report there were no conflicts of interest in this work.

  • 1. Pearson JS, Giogha C, Wong Fok Lung T, et al. The genetics of enteropathogenic Escherichia coli virulence. Annu Rev Genet 2016;50:493−13. PMID: 10.1146/annurev-genet-120215-035138. PMID: 27893961.ArticlePubMed
  • 2. Singh T, Das S, Ramachandran V, et al. Distribution of integrons and phylogenetic groups among enteropathogenic Escherichia coli isolates from children < 5 years of age in Delhi, India. Front Microbiol 2017;8:561PMID: 10.3389/fmicb.2017.00561.ArticlePubMedPMC
  • 3. Xu Y, Sun H, Bai X, et al. Occurrence of multidrug-resistant and ESBL-producing atypical enteropathogenic Escherichia coli in China. Gut Pathog 2018;10:8PMID: 10.1186/s13099-018-0234-0. PMID: 6054294.ArticlePubMedPMCPDF
  • 4. Babic M, Hujer AM, Bonomo RA. What’s new in antibiotic resistance? Focus on beta-lactamases. Drug Resist Updat 2006;9(3). 142−56. PMID: 10.1016/j.drup.2006.05.005. PMID: 16899402.ArticlePubMed
  • 5. Bush K, Bradford PA. Epidemiology of β-Lactamase-Producing Pathogens. Clin Microbiol Rev 2020;33(2). e00047−19. PMID: 10.1128/CMR.00047-19. PMID: 32102899. PMID: 7048014.ArticlePubMedPMC
  • 6. Alves H, de Cruz F, de Assis P, et al. Antibiotic resistance among Escherichia coli: Isolates and novel approaches to the control of E. coli infections. Recent Advances on Physiology, Pathogenesis and Biotechnological Applications. London (UK): Intech Open; 2017. pp 99−122.Article
  • 7. Erb A, Stürmer T, Marre R, et al. Prevalence of antibiotic resistance in Escherichia coli: Overview of geographical, temporal, and methodological variations. Eur J Clin Microbiol Infect Dis 2007;26(2). 83−90. PMID: 10.1007/s10096-006-0248-2. PMID: 17235554.ArticlePubMedPDF
  • 8. Pitondo-Silva A, Nakazato G, Falcão JP, et al. Phenotypic and genetic features of enteropathogenic Escherichia coli isolates from diarrheal children in the Ribeirão Preto metropolitan area, São Paulo State, Brazil. APMIS 2015;123(2). 128−35. PMID: 10.1111/apm.12314.ArticlePubMed
  • 9. Ochoa TJ, Contreras CA. Enteropathogenic E. coli (EPEC) infection in children. Curr Opin Infect Dis 2011;24(5). 478−83. PMID: 10.1097/QCO.0b013e32834a8b8b. PMID: 21857511. PMID: 3277943.ArticlePubMedPMC
  • 10. Scaletsky IC, Souza TB, Aranda KR, et al. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol 2010;10:25PMID: 10.1186/1471-2180-10-25. PMID: 20105329. PMID: 2828443.ArticlePubMedPMC
  • 11. Clermont O, Christenson JK, Denamur E, et al. The C lermont E scherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep 2013;5(1). 58−65. PMID: 10.1111/1758-2229.12019. PMID: 23757131.ArticlePubMed
  • 12. Reid CJ, Wyrsch ER, Chowdhury PR, et al. Porcine commensal Escherichia coli: A reservoir for class 1 integrons associated with IS26. Microb Genom 2017;3(12). e000143. ArticlePubMedPMC
  • 13. Nowrouzian FL, Clermont O, Edin M, et al. Escherichia coli B2 Phylogenetic Subgroups in the Infant Gut Microbiota: Predominance of Uropathogenic Lineages in Swedish Infants and Enteropathogenic Lineages in Pakistani Infants. Appl Environ Microbiol 2019;85(24). e01681−19. PMID: 10.1128/AEM.01681-19. PMID: 31562173. PMID: 6881811.ArticlePubMedPMC
  • 14. Younas M, Siddiqui F, Noreen Z, et al. Characterization of enteropathogenic Escherichia coli of clinical origin from the pediatric population in Pakistan. Trans R Soc Trop Med Hyg 2016;110(7). 414−20. PMID: 10.1093/trstmh/trw047. PMID: 27496516.ArticlePubMedPDF
  • 15. Mosquito S, Pons MJ, Riveros M, et al. Diarrheagenic Escherichia coli phylogroups are associated with antibiotic resistance and duration of diarrheal episode. Scientific World Journal 2015;2015:610403. PMID: 10.1155/2015/610403. PMID: 25811044. PMID: 4355820.ArticlePDF
  • 16. Carneiro L, Lins M, Garcia F, et al. Phenotypic and genotypic characterisation of Escherichia coli strains serogrouped as enteropathogenic E. coli (EPEC) isolated from pasteurised milk. Int J Food Microbiol 2006;108(1). 15−21. PMID: 10.1016/j.ijfoodmicro.2005.10.010. PMID: 16490272.ArticlePubMed
  • 17. Müller D, Greune L, Heusipp G, et al. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl Environ Microbiol 2007;73(10). 3380−90. PMID: 10.1128/AEM.02855-06. PMID: 17400780. PMID: 1907121.ArticlePubMedPMC
  • 18. Bauer A, Kirby W, Sherris JC, et al. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45(4). 493−6. PMID: 10.1093/ajcp/45.4_ts.493. PMID: 5325707.ArticlePubMedPDF
  • 19. Clinical and Laboratory Standards Institute (CLSI). M100 - Performance Standards for Antimicrobial Susceptibility Testing. 26th ed. CLSI supplement. 2016.
  • 20. Basak S, Singh P, Rajurkar M. Multidrug resistant and extensively drug resistant bacteria: A study. J Pathog 2016;2016:4065603. PMID: 10.1155/2016/4065603. PMID: 26942013. PMID: 4749793.ArticlePDF
  • 21. Navon-Venezia S, Chmelnitsky I, Leavitt A, et al. Dissemination of the CTX-M-25 family β-lactamases among Klebsiella pneumoniae, Escherichia coli and Enterobacter cloacae and identification of the novel enzyme CTX-M-41 in Proteus mirabilis in Israel. J Antimicrob Chemother 2008;62(2). 289−95. PMID: 10.1093/jac/dkn182. PMID: 18487232.ArticlePubMedPDF
  • 22. Van TTH, Chin J, Chapman T, et al. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol 2008;124(3). 217−23. PMID: 10.1016/j.ijfoodmicro.2008.03.029. PMID: 18457892.ArticlePubMed
  • 23. Karuniawati A, Saharman YR, Lestari DC. Detection of carbapenemase encoding genes in Enterobacteriace, Pseudomonas aeruginosa, and Acinetobacter baumanii isolated from patients at Intensive Care Unit Cipto Mangunkusumo Hospital in 2011. Acta Med Indones 2013;45(2). 101−6. PMID: 23770789.PubMed
  • 24. Maynou G, Migura-Garcia L, Chester-Jones H, et al. Effects of feeding pasteurized waste milk to dairy calves on phenotypes and genotypes of antimicrobial resistance in fecal Escherichia coli isolates before and after weaning. J Dairy Sci 2017;100(10). 7967−79. PMID: 10.3168/jds.2017-13040. PMID: 28755935.ArticlePubMed
  • 25. Dallal MS, Khorramizadeh M, MoezArdalan K. Occurrence of enteropathogenic bacteria in children under 5 years with diarrhoea in south Tehran. East Mediterr Health J 2006;12(6). 792−7.PubMed
  • 26. Afset JE, Bergh K, Bevanger L. High prevalence of atypical enteropathogenic Escherichia coli (EPEC) in Norwegian children with diarrhoea. J Med Microbiol 2003;52(11). 1015−19. PMID: 10.1099/jmm.0.05287-0. PMID: 14532347.ArticlePubMed
  • 27. Liu L, Johnson HL, Cousens S, et al. Global, regional, and national causes of child mortality: An updated systematic analysis for 2010 with time trends since 2000. Lancet 2012;379(9832). 2151−61. PMID: 10.1016/S0140-6736(12)60560-1. PMID: 22579125.ArticlePubMed
  • 28. Mahmoudi-aznaveh A, Bakhshi B, Najar-peerayeh S. The trend of enteropathogenic Escherichia coli towards atypical multidrug resistant genotypes. J Chemother 2017;29(1). 1−7. PMID: 10.1080/1120009X.2016.1154683.Article
  • 29. Vieira MA, Dos Santos L, Dias RC, et al. Atypical enteropathogenic escherichia coli as aetiologic agents of sporadic and outbreak associated diarrhoea in Brazil. J Med Microbiol 2016;65(9). 998−1006. PMID: 10.1099/jmm.0.000313. PMID: 27412254.ArticlePubMed
  • 30. Hernandes RT, Elias WP, Vieira MA, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett 2009;297(2). 137−49. PMID: 10.1111/j.1574-6968.2009.01664.x. PMID: 19527295.ArticlePubMedPDF
  • 31. Nair GB, Ramamurthy T, Bhattacharya MK, et al. Emerging trends in the etiology of enteric pathogens as evidenced from an active surveillance of hospitalized diarrhoeal patients in Kolkata, India. Gut Pathog 2010;2:4PMID: 10.1186/1757-4749-2-4. PMID: 20525383. PMID: 2901208.ArticlePubMedPMC
  • 32. Ochoa TJ, Barletta F, Contreras C, et al. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Transactions of Trans R Soc Trop Med Hyg 2008;102(9). 852−6. PMID: 10.1016/j.trstmh.2008.03.017.ArticlePDF
  • 33. Bakhshi B, Fallahzad S, Pourshafie MR. The occurrence of atypical enteropathogenic Escherichia coli strains among children with diarrhea in Iran. J Infect Chemother 2013;19(4). 615−20. PMID: 10.1007/s10156-012-0526-0.ArticlePubMed
  • 34. Oliveira PLd, Paula CS, Rocha LD, et al. Antimicrobial susceptibility profile of enterotoxigenic and enteropathogenic Escherichia coli isolates obtained from fecal specimens of children with acute diarrhea. J Bras Patol Med Lab 2017;53(2). 115−8.Article
  • 35. Seidman JC, Johnson LB, Levens J, et al. Longitudinal comparison of antibiotic resistance in diarrheagenic and non-pathogenic Escherichia coli from young Tanzanian children. Front Microbiol 2016;7:1420PMID: 10.3389/fmicb.2016.01420. PMID: 27656179. PMID: 5013055.ArticlePubMedPMC
  • 36. Ochoa TJ, Ruiz J, Molina M, et al. High frequency of antimicrobial drug resistance of diarrheagenic Escherichia coli in infants in Peru. Am J Trop Med Hyg 2009;81(2). 296−301. PMID: 10.4269/ajtmh.2009.81.296. PMID: 19635887. PMID: 2824507.ArticlePubMedPMC
  • 37. Memariani M, Peerayeh SN, Mostafavi SKS, et al. Detection of class 1 and 2 integrons among Enteropathogenic Escherichia coli isolates. Arch Pediatr Infect Dis 2014;2(4). e16372. Article
  • 38. Taghadosi R, Shakibaie MR, Hosseini-Nave H. Antibiotic resistance, ESBL genes, integrons, phylogenetic groups and MLVA profies of Escherichia coli pathotypes isolated from patients with diarrhea and farm animals in south-east of Iran. Comp Immunol Microbiol Infect Dis 2019;63:117−26. PMID: 10.1016/j.cimid.2019.01.004. PMID: 30961806.ArticlePubMed
  • 39. Haghighatpanah M, Nejad ASM, Mojtahedi A, et al. Detection of extended-spectrum β-lactamase (ESBL) and plasmid-borne blaCTX-M and blaTEM genes among clinical strains of Escherichia coli isolated from patients in the north of Iran. J Glob Antimicrob Resist 2016;7:110−3. PMID: 10.1016/j.jgar.2016.08.005. PMID: 27721192.ArticlePubMed
  • 40. Mandal A, Sengupta A, Kumar A, et al. Molecular Epidemiology of Extended-Spectrum β-Lactamase–Producing Escherichia coli Pathotypes in Diarrheal Children from Low Socioeconomic Status Communities in Bihar, India: Emergence of the CTX-M Type. Infect Dis (Auckl) 2017;10:1178633617739018. PMID: 10.1177/1178633617739018.ArticlePDF
  • 41. Wang L, Wakushima M, Aota T, et al. Specific properties of enteropathogenic Escherichia coli isolates from diarrheal patients and comparison to strains from foods and fecal specimens from cattle, swine, and healthy carriers in Osaka City, Japan. Appl Environ Microbiol 2013;79(4). 1232−40. PMID: 10.1128/AEM.03380-12. PMID: 3568616.ArticlePubMedPMC
Figure 1
Phylogrouping of EPEC strains on 2% agarose gel. arpA (400bp), chuA (288bp), yjaA (211bp) and TspE4.C2 (152bp). Lane 1, negative control; lane 2, molecular weight marker (50bp, Fermentas); lanes 3&4, group B1 (+ − − +); lanes 5&8, group E (+ + − +); lane 6&7, unknown (+ + + +); lanes 9&11, group E (+ + + −) and lanes 10&12, group C (+ − + −).
ophrp-11-327f1.jpg
Table 1
Antimicrobial susceptibility patterns.
Antibiotic All atypical EPEC isolates (n = 65)
Resistant Intermediate Sensitive
Cefotaxime 23 (35.4) 1 (1.53) 41 (63.1)
Ceftazidime 11 (16.9) 4 (6.15) 50 (76.9)
Piperacillin-tazo 2 (3.1) 1 (1.53) 62 (95.4)
Ertapenem - - 65 (100)
Imipenem - - 65 (100)
Ciprofloxacin 5 (7.7) 8 (12.3) 52 (80)
Tetracyclines 30 (46.2) 3 (4.61) 32 (49.2)
Amikacin - 3 (4.61) 62 (95.4)
Levofloxacin 5 (7.7) - 60 (92.3)
Ampicillin 46 (70.8) 4 (6.15) 15 (23.1)
Trimethoprim-sulfa 37 (56.9) 2 (3.07) 26 (40)

Data are presented as n (%).

EPEC = escherichia coli.

Table 2
Antimicrobial susceptibility patterns.
Antibiotic ESBL− isolates (n = 43) ESBL+ isolates (n = 22) p


Resistant Intermediate Sensitive Resistant Intermediate Sensitive
Cefotaxime 2 (4.6) - 41 (95.3) 21 (95.5) 1 (4.5) - < 0.001

Ceftazidime 2 (4.6) - 41 (95.3) 9 (40.9) 4 (18.2) 9 (40.9) < 0.001

Piperacillin-tazo 1 (2.3) 1 (2.3) 41 (95.3) 1 (4.5) - 21 (95.5) NS

Ertapenem - - 43 (100) - - 22 (100) -

Imipenem - - 43 (100) - - 22 (100) -

Ciprofloxacin 1 (2.3) 3 (7.0) 4 (18.2) 5 (22.7) 0.009

Tetracyclines 21 (48.8) 1 (2.3) 9 (40.9) 2 (9.1) NS

Amikacin - 3 (7.0) - - NS

Levofloxacin 1 (2.3) - 4 (18.2) - 0.023

Ampicillin 24 (55.8) 4 (9.3) 22 (100) - 0.001

Trimethoprim-sulfa 19 (44.2) 1 (2.3) 18 (81.8) 1 (4.5) 0.008

Data are presented as n (%).

ESBL = extended spectrum β-lactamase; NS = not significant.

Table 3
Genotypic pattern of 22 ESBL positive strains.
Resistance pattern n (%)
CTX-M9/SHV/OXA/TEM 2 (9.1)
CTX-M9/SHV/OXA 1 (4.5)
CTX-M9/SHV/TEM 2 (9.1)
CTX-M9/OXA/TEM 3 (13.6)
CTX-M9/SHV 3 (13.6)
CTX-M9/OXA 1 (4.5)
CTX-M9/TEM 2 (9.1)
SHV/TEM 2 (9.1)
CTX-M9 1 (4.5)
OXA 2 (9.1)
TEM 1 (4.5)
None 2 (9.1)

ESBL = extended spectrum β-lactamase.

Table 4
Phylogenetic grouping.
Phylogenetic group All atypical EPEC isolates (n = 65) ESBL− isolates (n = 43) ESBL+ isolates (n = 22)



n (%) n (%) n (%)
A 2 (3.07) 1 (2.3) 1 (4.5)

B1 13 (20) 13 (30.2) -

B2 9 (13.84) 6 (13.95) 3 (13.6)

C 8 (12.3) 5 (11.6) 3 (13.6)

D 2 (3.07) - 2 (9.1)

E 17 (26.15) 6 (13.95) 11 (50)

F - - -

Clade I 2 (3.07) 2 (4.65) -

Unknown 12 (18.5) 10 (23.25) 2 (9.1)

EPEC = escherichia coli; ESBL = extended spectrum β-lactamase.

Table 5
Antibiotic resistance patterns in atypical EPEC phylogenetic groups.
Phylogenetic group CTX CAZ TZP ETP IPM CIP Te AN LVX AM SXT
No. No. No. No. No. No. No. No. No. No. No.
A (n = 2) 2 2 1 0 0 1 2 0 1 2 2
B1 (n = 13) 1 0 0 0 0 1 8 0 1 9 7
B2 (n = 9) 3 2 0 0 0 0 4 0 0 6 4
C (n = 8) 3 0 0 0 0 0 3 0 0 7 4
D (n = 2) 2 1 0 0 0 0 0 0 0 2 0
E (n = 17) 10 5 0 0 0 3 7 0 3 14 13
Clade I (n = 2) 0 0 0 0 0 0 1 0 0 1 1
Unknown (n = 12) 2 1 1 0 0 0 5 0 0 5 6

AM = ampicillin; AN = amikacin; CAZ = ceftazidime; CIP = ciprofloxacin; CTX = cefotaxime; EPEC = escherichia coli; ETP = ertapenem; IPM = imipenem; LVX = levofloxacin; STX = trimethoprim + sulfamethoxazole; Te = tetracyclines; TZP = piperacillin + tazobactam.

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • Phenotypic and molecular characterization of enteropathogenic Escherichia coli and Salmonella spp. causing childhood diarrhoea in Awka, South-Eastern Nigeria
      Ifeanyi Emmanuel Nwike, Malachy Chigozie Ugwu, Peter Chika Ejikeugwu, Nonye Treasure Ujam, Ifeanyichukwu Romanus Iroha, Charles Okechukwu Esimone
      Bulletin of the National Research Centre.2023;[Epub]     CrossRef
    • Antimicrobial Resistance and Biofilm Formation of Escherichia coli Isolated from Pig Farms and Surroundings in Bulgaria
      Mila D. Kaleva, Yana Ilieva, Maya Margaritova Zaharieva, Lyudmila Dimitrova, Tanya Chan Kim, Iva Tsvetkova, Yordan Georgiev, Petya Orozova, Krasimir Nedev, Hristo Najdenski
      Microorganisms.2023; 11(8): 1909.     CrossRef
    • Isolation and Molecular Characterization of Proteus mirabilis Bacteria from Poultry Meat in the Iraqi Market and a Study of their Resistance to some Antibiotics
      Ammar H. Hamed, Ahmed I. Alnazzal
      IOP Conference Series: Earth and Environmental Sci.2023; 1262(6): 062019.     CrossRef
    • Virulence and phylogenetic analysis of enteric pathogenic Escherichia coli isolated from children with diarrhoea in South Africa
      Ntando W. Alfinete, John Y. Bolukaoto, Lee Heine, Natasha Potgieter, Tobias G. Barnard
      International Journal of Infectious Diseases.2022; 114: 226.     CrossRef
    • Prevalence of extended-spectrum β-lactamases, AmpC, and carbapenemases in Proteus mirabilis clinical isolates
      Mona Shaaban, Soha Lotfy Elshaer, Ola A. Abd El-Rahman
      BMC Microbiology.2022;[Epub]     CrossRef
    • Enteropathogenic Escherichia coli—A Summary of the Literature
      Anca Delia Mare, Cristina Nicoleta Ciurea, Adrian Man, Bianca Tudor, Valeriu Moldovan, Luminița Decean, Felicia Toma
      Gastroenterology Insights.2021; 12(1): 28.     CrossRef
    • Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Swine Faeces and Lagoons in Bulgaria
      Lyudmila Dimitrova, Mila Kaleva, Maya M. Zaharieva, Christina Stoykova, Iva Tsvetkova, Maya Angelovska, Yana Ilieva, Vesselin Kussovski, Sevda Naydenska, Hristo Najdenski
      Antibiotics.2021; 10(8): 940.     CrossRef

    Figure

    PHRP : Osong Public Health and Research Perspectives