Division of Arboviruses, Korea National Institute of Health, Osong, Korea
© 2011 Published by Elsevier B.V. on behalf of Korea Centers for Disease Control and Prevention.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Patient code/yr | Travel history | Serotype by RT-PCRa |
Virus isolationb |
||
---|---|---|---|---|---|
IFA | RT-PCR | Designation | |||
32/2004 | IU | 2 | – | – | |
38/2004 | IU | 3 | – | – | |
47/2004 | India, Singapore | 1, 2 | 1 | 1 | DenKor-01 |
09/2005 | Indonesia | 1 | 1 | 1 | DenKor-02 |
10/2005 | Indonesia | 1 | 1 | 1 | DenKor-03 |
12/2005 | Indonesia | 1 | 1 | 1 | DenKor-04 |
35/2005 | Thailand | 1 | 1 | 1 | DenKor-05 |
51/2005 | Philippines | 4 | – | – | |
108/2005 | India | 1 | – | – | |
115/2005 | Thailand | 1 | 1 | 1 | DenKor-06 |
64/2006 | Philippines | 1 | 1 | 1 | DenKor-07 |
Name | Sequence (5′–3′) | Positiona | Use |
---|---|---|---|
D1-820-S | GAGACACCCAGGATTCACGG | 820–839 | RT-PCR, Sequencing |
D1-2600-AS | TGGCTGATCGAATTCCACAC | 2581–2600 | RT-PCR, Sequencing |
1198-S | GAACTTTGTGTGYCGACGAAC | 1198–1218 | Sequencing |
1556-S | GTCCACAAACAATGGTTTC | 1556–1574 | Sequencing |
1913-S | GAAGGAACAGATGCACCATG | 1913–1932 | Sequencing |
1440-AS | GGAGCTTGAGGTGTTAT | 1424–1440 | Sequencing |
1932-AS | CATGGTGCATCTGTTCCTTC | 1913–1932 | Sequencing |
a Position refers to the position in the genome of the WestPac 74 strain (GenBank ID: U88535).
Strain | Code | Location | Isolation yr | GenBank IDa |
---|---|---|---|---|
RIO H 36589 | Ang88 | Angola | 1988 | AF425610 |
495–1 | Aru88 | Aruba | 1985 | AF425609 |
AUS HATI7 | Aus83 | Australia | 1983 | AF425612 |
BE AR 404147 | Bra82 | Brazil | 1982 | AF425613 |
BR/90 | Bra90 | Brazil | 1990 | S64849 |
BR/01-MR | Bra01 | Brazil | 2001 | AF513110 |
GZ/80 | Chi80 | China | 1980 | AF350498 |
INS 347869 | Col85 | Columbia | 1985 | AF425616 |
D1/H/IMTSSA/98/606 | Dji98 | Ethiopia | 1998 | AF298808 |
FGA/89 | Fre89 | French Guiana | 1989 | AF226687 |
A88 | Ind88 | Indonesia | 1988 | AB074761 |
98901518 DHF DV-1 | Ind98 | Indonesia | 1998 | AB189120 |
02-07-1HuNIID | Ind02 | Indonesia | 2002 | AB111073 |
SC01 | Ind04 | Indonesia | 2004 | AY858983 |
DenKor-02 | Ind05 | Indonesia | 2005 | EF654105 |
PRS 288690 | Jam77 | Jamaica | 1977 | AF425621 |
1298/TVP 951 | Mex80 | Mexico | 1980 | AF425623 |
PRS 228686 | Mya76 | Myanmar | 1976 | AF425615 |
My01D138862 | Mya01 | Myanmar | 2001 | AY618210 |
WestPac 74 | WestPac 74 | Nauru | 1974 | U88535 |
PRS 228682 | Phi74 | Philippines | 1974 | AF425627 |
01St219 | Phi01 | Philippines | 2001 | AY422777 |
02RBD008 | Phi02 | Philippines | 2002 | AY422778 |
DenKor-07 | DenKor-07 | Philippines | 2006 | EF654110 |
Singapore 8114/93 | Sin93 | Singapore | 1993 | AY762084 |
S144/02 | Sin02 | Singapore | 2002 | EU069600 |
T3196/04 | Sin04 | Singapore | 2004 | EU069624 |
DenKor-01 | DenKor-01 | India, Singapore | 2004 | EF654104 |
D1/SG/05K4173DK1/2005 | Sin05 | Singapore | 2005 | EU081262 |
D1/SG/06K2290DK1/2006 | Sin06 | Singapore | 2006 | EU081281 |
TH-SMAN | Tha54 | Thailand | 1954 | D10513 |
2543–63 | Tha63 | Thailand | 1963 | AF425629 |
16007 | Tha64 | Thailand | 1964 | AF180817 |
PUO 359 | Tha80 | Thailand | 1980 | AF425630 |
ThD1_K0229_90 | Tha90 | Thailand | 1990 | AY732466 |
ThD1_K0051_99 | Tha99 | Thailand | 1999 | AY732458 |
ThD1_0075_02 | Tha02 | Thailand | 2002 | AY732398 |
DenKor-05 | DenKor-05 | Thailand | 2005 | EF654108 |
DenKor-06 | DenKor-06 | Thailand | 2005 | EF654109 |
5345 | Ven95 | Venezuela | 1995 | AF425635 |